ID: 1048510477

View in Genome Browser
Species Human (GRCh38)
Location 8:135057359-135057381
Sequence CATCCTTCCCACGGTGCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048510477_1048510482 -6 Left 1048510477 8:135057359-135057381 CCTCACGCACCGTGGGAAGGATG No data
Right 1048510482 8:135057376-135057398 AGGATGTGGTGGGACGTGATTGG No data
1048510477_1048510484 2 Left 1048510477 8:135057359-135057381 CCTCACGCACCGTGGGAAGGATG No data
Right 1048510484 8:135057384-135057406 GTGGGACGTGATTGGATCATGGG No data
1048510477_1048510483 1 Left 1048510477 8:135057359-135057381 CCTCACGCACCGTGGGAAGGATG No data
Right 1048510483 8:135057383-135057405 GGTGGGACGTGATTGGATCATGG No data
1048510477_1048510485 3 Left 1048510477 8:135057359-135057381 CCTCACGCACCGTGGGAAGGATG No data
Right 1048510485 8:135057385-135057407 TGGGACGTGATTGGATCATGGGG No data
1048510477_1048510486 4 Left 1048510477 8:135057359-135057381 CCTCACGCACCGTGGGAAGGATG No data
Right 1048510486 8:135057386-135057408 GGGACGTGATTGGATCATGGGGG No data
1048510477_1048510487 7 Left 1048510477 8:135057359-135057381 CCTCACGCACCGTGGGAAGGATG No data
Right 1048510487 8:135057389-135057411 ACGTGATTGGATCATGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048510477 Original CRISPR CATCCTTCCCACGGTGCGTG AGG (reversed) Intergenic
No off target data available for this crispr