ID: 1048511751

View in Genome Browser
Species Human (GRCh38)
Location 8:135069433-135069455
Sequence AGGGGAATTTGCTGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048511751_1048511761 10 Left 1048511751 8:135069433-135069455 CCAGTTTTTCAGCAAATTCCCCT No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048511751 Original CRISPR AGGGGAATTTGCTGAAAAAC TGG (reversed) Intergenic