ID: 1048511754

View in Genome Browser
Species Human (GRCh38)
Location 8:135069452-135069474
Sequence AATACAGGGGACGGGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048511754_1048511761 -9 Left 1048511754 8:135069452-135069474 CCCTGGTCCCCGTCCCCTGTATT No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data
1048511754_1048511763 17 Left 1048511754 8:135069452-135069474 CCCTGGTCCCCGTCCCCTGTATT No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048511754 Original CRISPR AATACAGGGGACGGGGACCA GGG (reversed) Intergenic