ID: 1048511755

View in Genome Browser
Species Human (GRCh38)
Location 8:135069453-135069475
Sequence GAATACAGGGGACGGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048511755_1048511763 16 Left 1048511755 8:135069453-135069475 CCTGGTCCCCGTCCCCTGTATTC No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511755_1048511761 -10 Left 1048511755 8:135069453-135069475 CCTGGTCCCCGTCCCCTGTATTC No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048511755 Original CRISPR GAATACAGGGGACGGGGACC AGG (reversed) Intergenic