ID: 1048511755 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:135069453-135069475 |
| Sequence | GAATACAGGGGACGGGGACC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048511755_1048511763 | 16 | Left | 1048511755 | 8:135069453-135069475 | CCTGGTCCCCGTCCCCTGTATTC | No data | ||
| Right | 1048511763 | 8:135069492-135069514 | CACCGAGCACTCCCAAGTCCTGG | No data | ||||
| 1048511755_1048511761 | -10 | Left | 1048511755 | 8:135069453-135069475 | CCTGGTCCCCGTCCCCTGTATTC | No data | ||
| Right | 1048511761 | 8:135069466-135069488 | CCCTGTATTCGTGTTTCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048511755 | Original CRISPR | GAATACAGGGGACGGGGACC AGG (reversed) | Intergenic | ||