ID: 1048511761

View in Genome Browser
Species Human (GRCh38)
Location 8:135069466-135069488
Sequence CCCTGTATTCGTGTTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048511755_1048511761 -10 Left 1048511755 8:135069453-135069475 CCTGGTCCCCGTCCCCTGTATTC No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data
1048511751_1048511761 10 Left 1048511751 8:135069433-135069455 CCAGTTTTTCAGCAAATTCCCCT No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data
1048511754_1048511761 -9 Left 1048511754 8:135069452-135069474 CCCTGGTCCCCGTCCCCTGTATT No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data
1048511753_1048511761 -8 Left 1048511753 8:135069451-135069473 CCCCTGGTCCCCGTCCCCTGTAT No data
Right 1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048511761 Original CRISPR CCCTGTATTCGTGTTTCTCT TGG Intergenic