ID: 1048511763

View in Genome Browser
Species Human (GRCh38)
Location 8:135069492-135069514
Sequence CACCGAGCACTCCCAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048511754_1048511763 17 Left 1048511754 8:135069452-135069474 CCCTGGTCCCCGTCCCCTGTATT No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511762_1048511763 2 Left 1048511762 8:135069467-135069489 CCTGTATTCGTGTTTCTCTTGGT No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511758_1048511763 8 Left 1048511758 8:135069461-135069483 CCGTCCCCTGTATTCGTGTTTCT No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511759_1048511763 4 Left 1048511759 8:135069465-135069487 CCCCTGTATTCGTGTTTCTCTTG No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511757_1048511763 9 Left 1048511757 8:135069460-135069482 CCCGTCCCCTGTATTCGTGTTTC No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511756_1048511763 10 Left 1048511756 8:135069459-135069481 CCCCGTCCCCTGTATTCGTGTTT No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511753_1048511763 18 Left 1048511753 8:135069451-135069473 CCCCTGGTCCCCGTCCCCTGTAT No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511755_1048511763 16 Left 1048511755 8:135069453-135069475 CCTGGTCCCCGTCCCCTGTATTC No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data
1048511760_1048511763 3 Left 1048511760 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG No data
Right 1048511763 8:135069492-135069514 CACCGAGCACTCCCAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048511763 Original CRISPR CACCGAGCACTCCCAAGTCC TGG Intergenic