ID: 1048513024

View in Genome Browser
Species Human (GRCh38)
Location 8:135079440-135079462
Sequence CAGTAGTATTAGAGGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048513017_1048513024 28 Left 1048513017 8:135079389-135079411 CCAACATTGAGGATGGGCAGAAA No data
Right 1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048513024 Original CRISPR CAGTAGTATTAGAGGGTAAA GGG Intergenic
No off target data available for this crispr