ID: 1048513174 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:135080621-135080643 |
| Sequence | CAGTGTCAGCAGAAGGGGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048513174_1048513182 | 22 | Left | 1048513174 | 8:135080621-135080643 | CCCCACCCCTTCTGCTGACACTG | No data | ||
| Right | 1048513182 | 8:135080666-135080688 | CGACCCATCAACCACACCGCAGG | No data | ||||
| 1048513174_1048513185 | 29 | Left | 1048513174 | 8:135080621-135080643 | CCCCACCCCTTCTGCTGACACTG | No data | ||
| Right | 1048513185 | 8:135080673-135080695 | TCAACCACACCGCAGGCCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048513174 | Original CRISPR | CAGTGTCAGCAGAAGGGGTG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||