ID: 1048513174

View in Genome Browser
Species Human (GRCh38)
Location 8:135080621-135080643
Sequence CAGTGTCAGCAGAAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048513174_1048513182 22 Left 1048513174 8:135080621-135080643 CCCCACCCCTTCTGCTGACACTG No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data
1048513174_1048513185 29 Left 1048513174 8:135080621-135080643 CCCCACCCCTTCTGCTGACACTG No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048513174 Original CRISPR CAGTGTCAGCAGAAGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr