ID: 1048513182

View in Genome Browser
Species Human (GRCh38)
Location 8:135080666-135080688
Sequence CGACCCATCAACCACACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048513178_1048513182 16 Left 1048513178 8:135080627-135080649 CCCTTCTGCTGACACTGTTGTTC No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data
1048513179_1048513182 15 Left 1048513179 8:135080628-135080650 CCTTCTGCTGACACTGTTGTTCA No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data
1048513176_1048513182 20 Left 1048513176 8:135080623-135080645 CCACCCCTTCTGCTGACACTGTT No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data
1048513177_1048513182 17 Left 1048513177 8:135080626-135080648 CCCCTTCTGCTGACACTGTTGTT No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data
1048513174_1048513182 22 Left 1048513174 8:135080621-135080643 CCCCACCCCTTCTGCTGACACTG No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data
1048513175_1048513182 21 Left 1048513175 8:135080622-135080644 CCCACCCCTTCTGCTGACACTGT No data
Right 1048513182 8:135080666-135080688 CGACCCATCAACCACACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048513182 Original CRISPR CGACCCATCAACCACACCGC AGG Intergenic
No off target data available for this crispr