ID: 1048513185

View in Genome Browser
Species Human (GRCh38)
Location 8:135080673-135080695
Sequence TCAACCACACCGCAGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048513174_1048513185 29 Left 1048513174 8:135080621-135080643 CCCCACCCCTTCTGCTGACACTG No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513176_1048513185 27 Left 1048513176 8:135080623-135080645 CCACCCCTTCTGCTGACACTGTT No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513175_1048513185 28 Left 1048513175 8:135080622-135080644 CCCACCCCTTCTGCTGACACTGT No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513180_1048513185 -8 Left 1048513180 8:135080658-135080680 CCCATCATCGACCCATCAACCAC No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513181_1048513185 -9 Left 1048513181 8:135080659-135080681 CCATCATCGACCCATCAACCACA No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513179_1048513185 22 Left 1048513179 8:135080628-135080650 CCTTCTGCTGACACTGTTGTTCA No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513177_1048513185 24 Left 1048513177 8:135080626-135080648 CCCCTTCTGCTGACACTGTTGTT No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data
1048513178_1048513185 23 Left 1048513178 8:135080627-135080649 CCCTTCTGCTGACACTGTTGTTC No data
Right 1048513185 8:135080673-135080695 TCAACCACACCGCAGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048513185 Original CRISPR TCAACCACACCGCAGGCCTG AGG Intergenic
No off target data available for this crispr