ID: 1048514918

View in Genome Browser
Species Human (GRCh38)
Location 8:135097463-135097485
Sequence CTCAACCAACACCCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048514918_1048514923 -6 Left 1048514918 8:135097463-135097485 CCCCCATTAGGGTGTTGGTTGAG No data
Right 1048514923 8:135097480-135097502 GTTGAGATCACATGGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048514918 Original CRISPR CTCAACCAACACCCTAATGG GGG (reversed) Intergenic
No off target data available for this crispr