ID: 1048518430

View in Genome Browser
Species Human (GRCh38)
Location 8:135131895-135131917
Sequence GAAGGCCTTGTGTAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048518430_1048518437 21 Left 1048518430 8:135131895-135131917 CCCCCAAACTACACAAGGCCTTC No data
Right 1048518437 8:135131939-135131961 TCTGTAAAGCCATATCCACCAGG No data
1048518430_1048518438 22 Left 1048518430 8:135131895-135131917 CCCCCAAACTACACAAGGCCTTC No data
Right 1048518438 8:135131940-135131962 CTGTAAAGCCATATCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048518430 Original CRISPR GAAGGCCTTGTGTAGTTTGG GGG (reversed) Intergenic
No off target data available for this crispr