ID: 1048525614

View in Genome Browser
Species Human (GRCh38)
Location 8:135199712-135199734
Sequence CTGCTCTTCTTTAGGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048525614_1048525617 -10 Left 1048525614 8:135199712-135199734 CCTAATTTCCTAAAGAAGAGCAG No data
Right 1048525617 8:135199725-135199747 AGAAGAGCAGGATAGTATAGAGG No data
1048525614_1048525618 20 Left 1048525614 8:135199712-135199734 CCTAATTTCCTAAAGAAGAGCAG No data
Right 1048525618 8:135199755-135199777 CATTATAAAGATATATCCAAAGG No data
1048525614_1048525619 21 Left 1048525614 8:135199712-135199734 CCTAATTTCCTAAAGAAGAGCAG No data
Right 1048525619 8:135199756-135199778 ATTATAAAGATATATCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048525614 Original CRISPR CTGCTCTTCTTTAGGAAATT AGG (reversed) Intergenic
No off target data available for this crispr