ID: 1048526043

View in Genome Browser
Species Human (GRCh38)
Location 8:135203764-135203786
Sequence CTAATATTCCGAATCTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048526041_1048526043 11 Left 1048526041 8:135203730-135203752 CCTCATTAAACTAATTAAACAAG No data
Right 1048526043 8:135203764-135203786 CTAATATTCCGAATCTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048526043 Original CRISPR CTAATATTCCGAATCTATAA GGG Intergenic
No off target data available for this crispr