ID: 1048526767

View in Genome Browser
Species Human (GRCh38)
Location 8:135210017-135210039
Sequence TGCTGAACACCATGCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048526767_1048526773 16 Left 1048526767 8:135210017-135210039 CCTGCCCAGCATGGTGTTCAGCA No data
Right 1048526773 8:135210056-135210078 TAAACTTTTATTGATTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048526767 Original CRISPR TGCTGAACACCATGCTGGGC AGG (reversed) Intergenic
No off target data available for this crispr