ID: 1048526773

View in Genome Browser
Species Human (GRCh38)
Location 8:135210056-135210078
Sequence TAAACTTTTATTGATTGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048526767_1048526773 16 Left 1048526767 8:135210017-135210039 CCTGCCCAGCATGGTGTTCAGCA No data
Right 1048526773 8:135210056-135210078 TAAACTTTTATTGATTGACGAGG No data
1048526768_1048526773 12 Left 1048526768 8:135210021-135210043 CCCAGCATGGTGTTCAGCACAGG No data
Right 1048526773 8:135210056-135210078 TAAACTTTTATTGATTGACGAGG No data
1048526770_1048526773 11 Left 1048526770 8:135210022-135210044 CCAGCATGGTGTTCAGCACAGGA No data
Right 1048526773 8:135210056-135210078 TAAACTTTTATTGATTGACGAGG No data
1048526766_1048526773 20 Left 1048526766 8:135210013-135210035 CCTTCCTGCCCAGCATGGTGTTC No data
Right 1048526773 8:135210056-135210078 TAAACTTTTATTGATTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048526773 Original CRISPR TAAACTTTTATTGATTGACG AGG Intergenic
No off target data available for this crispr