ID: 1048527809

View in Genome Browser
Species Human (GRCh38)
Location 8:135219952-135219974
Sequence CAGGATACACAGAAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048527802_1048527809 20 Left 1048527802 8:135219909-135219931 CCAGACATTTAGATTCTAGATCT No data
Right 1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048527809 Original CRISPR CAGGATACACAGAAGGATGC AGG Intergenic
No off target data available for this crispr