ID: 1048529743 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:135236448-135236470 |
| Sequence | GTTTTCAAGGGGGTTATTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048529733_1048529743 | 27 | Left | 1048529733 | 8:135236398-135236420 | CCACTGAGCCATAGGTCAAGGGG | No data | ||
| Right | 1048529743 | 8:135236448-135236470 | GTTTTCAAGGGGGTTATTGATGG | No data | ||||
| 1048529731_1048529743 | 28 | Left | 1048529731 | 8:135236397-135236419 | CCCACTGAGCCATAGGTCAAGGG | No data | ||
| Right | 1048529743 | 8:135236448-135236470 | GTTTTCAAGGGGGTTATTGATGG | No data | ||||
| 1048529737_1048529743 | 19 | Left | 1048529737 | 8:135236406-135236428 | CCATAGGTCAAGGGGTTCTGGGT | No data | ||
| Right | 1048529743 | 8:135236448-135236470 | GTTTTCAAGGGGGTTATTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048529743 | Original CRISPR | GTTTTCAAGGGGGTTATTGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||