ID: 1048529743

View in Genome Browser
Species Human (GRCh38)
Location 8:135236448-135236470
Sequence GTTTTCAAGGGGGTTATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048529733_1048529743 27 Left 1048529733 8:135236398-135236420 CCACTGAGCCATAGGTCAAGGGG No data
Right 1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG No data
1048529731_1048529743 28 Left 1048529731 8:135236397-135236419 CCCACTGAGCCATAGGTCAAGGG No data
Right 1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG No data
1048529737_1048529743 19 Left 1048529737 8:135236406-135236428 CCATAGGTCAAGGGGTTCTGGGT No data
Right 1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048529743 Original CRISPR GTTTTCAAGGGGGTTATTGA TGG Intergenic
No off target data available for this crispr