ID: 1048534227

View in Genome Browser
Species Human (GRCh38)
Location 8:135277484-135277506
Sequence CATTATGCACCATCGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048534221_1048534227 28 Left 1048534221 8:135277433-135277455 CCACAGGATTGTGGGGTAGTTTG No data
Right 1048534227 8:135277484-135277506 CATTATGCACCATCGGAGAAGGG No data
1048534223_1048534227 -3 Left 1048534223 8:135277464-135277486 CCAGAGATAACTGGAATAACCAT No data
Right 1048534227 8:135277484-135277506 CATTATGCACCATCGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048534227 Original CRISPR CATTATGCACCATCGGAGAA GGG Intergenic
No off target data available for this crispr