ID: 1048538658

View in Genome Browser
Species Human (GRCh38)
Location 8:135322222-135322244
Sequence CATGGTCAGTGACCTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048538658_1048538667 16 Left 1048538658 8:135322222-135322244 CCCCCTGGAGGTCACTGACCATG No data
Right 1048538667 8:135322261-135322283 CTGAATATTTAGATGAGACAGGG No data
1048538658_1048538666 15 Left 1048538658 8:135322222-135322244 CCCCCTGGAGGTCACTGACCATG No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data
1048538658_1048538664 -7 Left 1048538658 8:135322222-135322244 CCCCCTGGAGGTCACTGACCATG No data
Right 1048538664 8:135322238-135322260 GACCATGGAAATGATATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048538658 Original CRISPR CATGGTCAGTGACCTCCAGG GGG (reversed) Intergenic
No off target data available for this crispr