ID: 1048538662

View in Genome Browser
Species Human (GRCh38)
Location 8:135322225-135322247
Sequence TTCCATGGTCAGTGACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048538662_1048538667 13 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538667 8:135322261-135322283 CTGAATATTTAGATGAGACAGGG No data
1048538662_1048538668 29 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538668 8:135322277-135322299 GACAGGGTACCCTACTCAAGTGG No data
1048538662_1048538664 -10 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538664 8:135322238-135322260 GACCATGGAAATGATATGGTTGG No data
1048538662_1048538666 12 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048538662 Original CRISPR TTCCATGGTCAGTGACCTCC AGG (reversed) Intergenic
No off target data available for this crispr