ID: 1048538664

View in Genome Browser
Species Human (GRCh38)
Location 8:135322238-135322260
Sequence GACCATGGAAATGATATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048538658_1048538664 -7 Left 1048538658 8:135322222-135322244 CCCCCTGGAGGTCACTGACCATG No data
Right 1048538664 8:135322238-135322260 GACCATGGAAATGATATGGTTGG No data
1048538662_1048538664 -10 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538664 8:135322238-135322260 GACCATGGAAATGATATGGTTGG No data
1048538659_1048538664 -8 Left 1048538659 8:135322223-135322245 CCCCTGGAGGTCACTGACCATGG No data
Right 1048538664 8:135322238-135322260 GACCATGGAAATGATATGGTTGG No data
1048538661_1048538664 -9 Left 1048538661 8:135322224-135322246 CCCTGGAGGTCACTGACCATGGA No data
Right 1048538664 8:135322238-135322260 GACCATGGAAATGATATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048538664 Original CRISPR GACCATGGAAATGATATGGT TGG Intergenic
No off target data available for this crispr