ID: 1048538665

View in Genome Browser
Species Human (GRCh38)
Location 8:135322240-135322262
Sequence AGCCAACCATATCATTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048538665_1048538666 -3 Left 1048538665 8:135322240-135322262 CCATGGAAATGATATGGTTGGCT No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data
1048538665_1048538669 20 Left 1048538665 8:135322240-135322262 CCATGGAAATGATATGGTTGGCT No data
Right 1048538669 8:135322283-135322305 GTACCCTACTCAAGTGGCAGAGG No data
1048538665_1048538668 14 Left 1048538665 8:135322240-135322262 CCATGGAAATGATATGGTTGGCT No data
Right 1048538668 8:135322277-135322299 GACAGGGTACCCTACTCAAGTGG No data
1048538665_1048538667 -2 Left 1048538665 8:135322240-135322262 CCATGGAAATGATATGGTTGGCT No data
Right 1048538667 8:135322261-135322283 CTGAATATTTAGATGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048538665 Original CRISPR AGCCAACCATATCATTTCCA TGG (reversed) Intergenic
No off target data available for this crispr