ID: 1048538666

View in Genome Browser
Species Human (GRCh38)
Location 8:135322260-135322282
Sequence GCTGAATATTTAGATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048538665_1048538666 -3 Left 1048538665 8:135322240-135322262 CCATGGAAATGATATGGTTGGCT No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data
1048538662_1048538666 12 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data
1048538658_1048538666 15 Left 1048538658 8:135322222-135322244 CCCCCTGGAGGTCACTGACCATG No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data
1048538659_1048538666 14 Left 1048538659 8:135322223-135322245 CCCCTGGAGGTCACTGACCATGG No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data
1048538661_1048538666 13 Left 1048538661 8:135322224-135322246 CCCTGGAGGTCACTGACCATGGA No data
Right 1048538666 8:135322260-135322282 GCTGAATATTTAGATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048538666 Original CRISPR GCTGAATATTTAGATGAGAC AGG Intergenic
No off target data available for this crispr