ID: 1048538668

View in Genome Browser
Species Human (GRCh38)
Location 8:135322277-135322299
Sequence GACAGGGTACCCTACTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048538661_1048538668 30 Left 1048538661 8:135322224-135322246 CCCTGGAGGTCACTGACCATGGA No data
Right 1048538668 8:135322277-135322299 GACAGGGTACCCTACTCAAGTGG No data
1048538662_1048538668 29 Left 1048538662 8:135322225-135322247 CCTGGAGGTCACTGACCATGGAA No data
Right 1048538668 8:135322277-135322299 GACAGGGTACCCTACTCAAGTGG No data
1048538665_1048538668 14 Left 1048538665 8:135322240-135322262 CCATGGAAATGATATGGTTGGCT No data
Right 1048538668 8:135322277-135322299 GACAGGGTACCCTACTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048538668 Original CRISPR GACAGGGTACCCTACTCAAG TGG Intergenic
No off target data available for this crispr