ID: 1048539116

View in Genome Browser
Species Human (GRCh38)
Location 8:135326413-135326435
Sequence GTGGTTACACAGGTCTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048539107_1048539116 21 Left 1048539107 8:135326369-135326391 CCACAGTTGGGGAAATTTCTTGG No data
Right 1048539116 8:135326413-135326435 GTGGTTACACAGGTCTGAGAGGG No data
1048539111_1048539116 -5 Left 1048539111 8:135326395-135326417 CCAGGATAGCCATGCCAAGTGGT No data
Right 1048539116 8:135326413-135326435 GTGGTTACACAGGTCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048539116 Original CRISPR GTGGTTACACAGGTCTGAGA GGG Intergenic
No off target data available for this crispr