ID: 1048544581

View in Genome Browser
Species Human (GRCh38)
Location 8:135374582-135374604
Sequence CTGGGCTCGCTCCCCTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048544577_1048544581 10 Left 1048544577 8:135374549-135374571 CCTAATTCACTTACGTTAACTCA No data
Right 1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048544581 Original CRISPR CTGGGCTCGCTCCCCTCACC AGG Intergenic
No off target data available for this crispr