ID: 1048548240

View in Genome Browser
Species Human (GRCh38)
Location 8:135406700-135406722
Sequence CAGGAGGCTGCACTAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048548235_1048548240 -8 Left 1048548235 8:135406685-135406707 CCTACACACCACCCACAGGAGGC No data
Right 1048548240 8:135406700-135406722 CAGGAGGCTGCACTAGGTCAAGG No data
1048548232_1048548240 20 Left 1048548232 8:135406657-135406679 CCTTGAGATGCTGTAGGGAACAA No data
Right 1048548240 8:135406700-135406722 CAGGAGGCTGCACTAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048548240 Original CRISPR CAGGAGGCTGCACTAGGTCA AGG Intergenic
No off target data available for this crispr