ID: 1048549331

View in Genome Browser
Species Human (GRCh38)
Location 8:135419481-135419503
Sequence CCCTTCTTCCTGTACATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048549331_1048549334 16 Left 1048549331 8:135419481-135419503 CCTATTATGTACAGGAAGAAGGG No data
Right 1048549334 8:135419520-135419542 TGTGGTGCTTTGCAATCAGCTGG No data
1048549331_1048549335 23 Left 1048549331 8:135419481-135419503 CCTATTATGTACAGGAAGAAGGG No data
Right 1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG No data
1048549331_1048549333 -2 Left 1048549331 8:135419481-135419503 CCTATTATGTACAGGAAGAAGGG No data
Right 1048549333 8:135419502-135419524 GGAAATGTATCTTAGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048549331 Original CRISPR CCCTTCTTCCTGTACATAAT AGG (reversed) Intergenic
No off target data available for this crispr