ID: 1048549335

View in Genome Browser
Species Human (GRCh38)
Location 8:135419527-135419549
Sequence CTTTGCAATCAGCTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048549331_1048549335 23 Left 1048549331 8:135419481-135419503 CCTATTATGTACAGGAAGAAGGG No data
Right 1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048549335 Original CRISPR CTTTGCAATCAGCTGGAGCT AGG Intergenic
No off target data available for this crispr