ID: 1048550176

View in Genome Browser
Species Human (GRCh38)
Location 8:135426768-135426790
Sequence TTATTTAGGAATAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048550170_1048550176 -6 Left 1048550170 8:135426751-135426773 CCCACCCGAGACACACTTTATTT No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550168_1048550176 -4 Left 1048550168 8:135426749-135426771 CCCCCACCCGAGACACACTTTAT No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550166_1048550176 3 Left 1048550166 8:135426742-135426764 CCTCCAACCCCCACCCGAGACAC No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550171_1048550176 -7 Left 1048550171 8:135426752-135426774 CCACCCGAGACACACTTTATTTA No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550173_1048550176 -10 Left 1048550173 8:135426755-135426777 CCCGAGACACACTTTATTTAGGA No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550165_1048550176 4 Left 1048550165 8:135426741-135426763 CCCTCCAACCCCCACCCGAGACA No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550167_1048550176 0 Left 1048550167 8:135426745-135426767 CCAACCCCCACCCGAGACACACT No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550169_1048550176 -5 Left 1048550169 8:135426750-135426772 CCCCACCCGAGACACACTTTATT No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data
1048550164_1048550176 5 Left 1048550164 8:135426740-135426762 CCCCTCCAACCCCCACCCGAGAC No data
Right 1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048550176 Original CRISPR TTATTTAGGAATAAGAAGGA AGG Intergenic
No off target data available for this crispr