ID: 1048551940

View in Genome Browser
Species Human (GRCh38)
Location 8:135441655-135441677
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048551937_1048551940 16 Left 1048551937 8:135441616-135441638 CCGAGACTGGGTACTTTATAAAG 0: 35
1: 3566
2: 4502
3: 3304
4: 3225
Right 1048551940 8:135441655-135441677 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1048551936_1048551940 17 Left 1048551936 8:135441615-135441637 CCCGAGACTGGGTACTTTATAAA 0: 64
1: 6803
2: 13420
3: 14371
4: 11504
Right 1048551940 8:135441655-135441677 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048551940 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr