ID: 1048553981

View in Genome Browser
Species Human (GRCh38)
Location 8:135457626-135457648
Sequence GCCCGGAGCGCGGGGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 499}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048553966_1048553981 6 Left 1048553966 8:135457597-135457619 CCGCCCGCGCCCGCTCCTCCTCG 0: 1
1: 0
2: 10
3: 62
4: 688
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553961_1048553981 27 Left 1048553961 8:135457576-135457598 CCGAGGGCCCGCCTAACCGCGCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553973_1048553981 -9 Left 1048553973 8:135457612-135457634 CCTCCTCGGCCCGCGCCCGGAGC 0: 1
1: 0
2: 5
3: 29
4: 353
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553971_1048553981 -4 Left 1048553971 8:135457607-135457629 CCGCTCCTCCTCGGCCCGCGCCC 0: 1
1: 0
2: 14
3: 90
4: 714
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553962_1048553981 20 Left 1048553962 8:135457583-135457605 CCCGCCTAACCGCGCCGCCCGCG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553960_1048553981 28 Left 1048553960 8:135457575-135457597 CCCGAGGGCCCGCCTAACCGCGC 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553963_1048553981 19 Left 1048553963 8:135457584-135457606 CCGCCTAACCGCGCCGCCCGCGC 0: 1
1: 0
2: 3
3: 18
4: 131
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553968_1048553981 3 Left 1048553968 8:135457600-135457622 CCCGCGCCCGCTCCTCCTCGGCC 0: 1
1: 0
2: 6
3: 68
4: 700
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553969_1048553981 2 Left 1048553969 8:135457601-135457623 CCGCGCCCGCTCCTCCTCGGCCC 0: 1
1: 0
2: 7
3: 88
4: 795
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553964_1048553981 16 Left 1048553964 8:135457587-135457609 CCTAACCGCGCCGCCCGCGCCCG 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553970_1048553981 -3 Left 1048553970 8:135457606-135457628 CCCGCTCCTCCTCGGCCCGCGCC 0: 1
1: 0
2: 9
3: 119
4: 749
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499
1048553965_1048553981 11 Left 1048553965 8:135457592-135457614 CCGCGCCGCCCGCGCCCGCTCCT 0: 1
1: 2
2: 12
3: 106
4: 786
Right 1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG 0: 1
1: 0
2: 7
3: 78
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048553981 Original CRISPR GCCCGGAGCGCGGGGGCCGC CGG Exonic
900076062 1:818776-818798 GTCCGGAGGGCGGGGACTGCAGG - Intergenic
900096683 1:942730-942752 GTCCGGAGCCCGGGGGCCCCTGG - Exonic
900103870 1:974071-974093 GCCCGGAGCCCGGGGCACACGGG - Intronic
900391364 1:2435365-2435387 GCCCAGAGCCCGGGGACCCCTGG - Intronic
900413898 1:2526383-2526405 GGCCGGCGAGCGGGGGCGGCGGG - Intronic
900511715 1:3063925-3063947 GCCCGCAACCCCGGGGCCGCCGG - Intergenic
900671299 1:3856808-3856830 GCGCGGGGCGCGGGCGCCGCGGG - Intronic
901005470 1:6169768-6169790 GGCTGGGGCGCTGGGGCCGCAGG - Intronic
901018022 1:6242651-6242673 GCCCGGACCGCAGGGCCCGCGGG - Intergenic
901022287 1:6261388-6261410 GCCCGGAGCTCTGGGGGCCCGGG + Intergenic
901238525 1:7680124-7680146 GTCGGGAGCGCGGGGGTCCCGGG + Intronic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901648403 1:10728874-10728896 GCCCAGCACACGGGGGCCGCAGG + Intronic
902415636 1:16237115-16237137 GCCCGGCGGGCTGGGGCGGCGGG - Exonic
902600903 1:17539730-17539752 CCTCGGAGCGCGGCGGGCGCGGG + Intergenic
903132768 1:21290327-21290349 GCCTGGAGGGCGGGGGCGGGAGG - Intronic
903153285 1:21428207-21428229 GGCCGGAGCGCGGGCGGCGGCGG + Intergenic
903839117 1:26225653-26225675 GCCTGGAGCGCGGCGGCAGCTGG + Intergenic
904236729 1:29121720-29121742 GCGGGGAGCGCGGGCGCCGGCGG + Exonic
904744471 1:32702631-32702653 GCCCGGAGCCCCGGCGCGGCGGG - Exonic
904744493 1:32702705-32702727 CGCCGGAGCGAGGGGCCCGCGGG - Exonic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904822893 1:33256665-33256687 GCCCGGGGCGCGCGGGGAGCGGG + Intronic
905037825 1:34929346-34929368 GCCCGGGGCGTGGGCGGCGCCGG + Intronic
905066895 1:35192260-35192282 GCCCGCCGGGCGGGGGCCCCTGG + Exonic
905107606 1:35573697-35573719 TCTCGGAGGGAGGGGGCCGCAGG + Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
905393982 1:37655686-37655708 GGCGGGAGCGCGGGGGTCCCGGG - Intergenic
905789771 1:40783910-40783932 GCTCGGAGCCTGGGGGCCGCCGG - Intergenic
906027026 1:42682608-42682630 GCGCTGAGGGCGGGGGCGGCGGG - Exonic
906214245 1:44030120-44030142 GCCCGAGGCGCGGAGGCCTCCGG + Intronic
906615831 1:47232238-47232260 GGCGGGGGAGCGGGGGCCGCGGG - Intergenic
907442874 1:54489421-54489443 GCGCGCAGCGCGGGAGCCCCCGG + Intergenic
907909940 1:58816558-58816580 GCCTGGGGCTCTGGGGCCGCCGG - Intergenic
909392907 1:75136358-75136380 ACCCGGAGCCCGGGGAGCGCGGG + Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
911440512 1:97920786-97920808 CTCCGGGGTGCGGGGGCCGCGGG + Intronic
913027127 1:114854860-114854882 GCCCGGAGCGCGTGGGCCCCGGG - Exonic
914197340 1:145454431-145454453 GCCCGGGGCGGCGGGGCCGGCGG - Intergenic
915559302 1:156677133-156677155 GCGCGGAGCTCGGGGGGCTCCGG - Exonic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
918040775 1:180912828-180912850 GCGCGGAGAGGTGGGGCCGCGGG - Intergenic
919892040 1:201982705-201982727 GCGCGGAGTGCAGCGGCCGCCGG - Exonic
920001973 1:202807138-202807160 GCCCGGAGCCTGAGGGCCGGGGG + Intronic
920021230 1:202958125-202958147 GGCGGGAGCGCGGGGACCCCGGG - Intronic
921944851 1:220879568-220879590 GCGAGGGGCGCTGGGGCCGCAGG - Exonic
922851300 1:228735807-228735829 GTCGGGAGCGCGGTGGACGCGGG + Exonic
923055967 1:230426110-230426132 CCTCGGAGCTCGGGCGCCGCAGG + Intergenic
923684163 1:236142445-236142467 GGTCGGCGCGCGGGGGCGGCGGG + Intergenic
1062843695 10:689419-689441 GCGCGGAGGGCTGGGGGCGCGGG - Intronic
1062895005 10:1096692-1096714 GCGCGCAGAGCGGGGGCTGCTGG + Intronic
1063511354 10:6647842-6647864 GGCCGCAGCGCGGGGCCCGGCGG + Intergenic
1063994988 10:11611214-11611236 GCCCGGAGCGTGGGGTCCGCGGG - Intronic
1064244313 10:13657139-13657161 GCGGGGGGCGCGGGGGGCGCGGG - Exonic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1065883719 10:30059190-30059212 GCTCGGAGCGCGGGGGTCCCGGG - Intronic
1066464418 10:35640378-35640400 GCGCCGGGCGCGGGGGGCGCTGG - Exonic
1067416354 10:46106239-46106261 GCCAGGAGAGCGGAGGCGGCGGG + Intergenic
1067937320 10:50623456-50623478 GCTCGGAGGGGGCGGGCCGCCGG - Intronic
1069615065 10:69801729-69801751 GGCCGGCGGGCTGGGGCCGCCGG + Intergenic
1070570703 10:77637906-77637928 GCCCGGGGCGAGCGGGGCGCGGG - Intronic
1070768478 10:79069457-79069479 GCCGGGAGCTCGCCGGCCGCCGG - Intronic
1072680084 10:97499572-97499594 GCCGGGGGCGAGGGCGCCGCTGG + Intronic
1072700942 10:97640935-97640957 GCCCGGGGCGCGGCGGCCCAGGG + Exonic
1072783987 10:98268234-98268256 GCTCGGGGCTGGGGGGCCGCGGG - Exonic
1073286711 10:102394156-102394178 GCCCCGAGGGCTGGGGCCGTCGG + Intronic
1073325961 10:102644109-102644131 GGCCGGAGCCCGGGGTCTGCGGG - Intergenic
1075065780 10:119288063-119288085 GCCCAGAGCGGGGAGGCCGTGGG + Intronic
1076655273 10:132019594-132019616 GCCTGGAGGGTGGGGGCCGCAGG + Intergenic
1076721981 10:132396863-132396885 GCCACGAGCCCGGGGGCGGCGGG - Intergenic
1076726804 10:132417643-132417665 TCCCAGAGCGTGGGGCCCGCTGG + Exonic
1076793000 10:132786574-132786596 GCCCGGAGCGCGTTCCCCGCCGG - Intergenic
1076841585 10:133048564-133048586 GCCCGGAGGGTGGAGGCAGCAGG + Intergenic
1077008159 11:368962-368984 GCCTGCAGGGCTGGGGCCGCAGG - Intergenic
1077008507 11:369962-369984 GCGGGGGGCGCGGGGGGCGCGGG + Intronic
1077008527 11:369998-370020 GCGGGGGGCGCGGGGGGCGCGGG + Intronic
1077043678 11:535320-535342 GCCGGGGGCGCGGGGCCGGCGGG - Intronic
1077250152 11:1557299-1557321 GCCGGGGGCGTGGGGGGCGCGGG + Exonic
1077505793 11:2929511-2929533 GCCCGGGGCGCGCGGGGCTCAGG - Intergenic
1077891162 11:6419077-6419099 CCCAGGAGCGCGCGGGCCGCGGG + Intronic
1079361957 11:19777129-19777151 CCTCGCAGCGCGGAGGCCGCTGG - Intronic
1080802243 11:35619100-35619122 CCCTGGAGCGCGGGGGTTGCGGG + Exonic
1081700014 11:45146942-45146964 CCAGCGAGCGCGGGGGCCGCCGG + Intronic
1081831963 11:46121662-46121684 GCGGGGAGGGAGGGGGCCGCCGG + Intergenic
1082003753 11:47408679-47408701 GCCCGGGGCGCGGGCCCCGAGGG - Intronic
1082025048 11:47565578-47565600 ACCGCGAGCGCGGGGGCCGACGG + Intronic
1082807618 11:57460696-57460718 GCCCGCAGCCCGGGCGGCGCAGG + Exonic
1083721867 11:64607465-64607487 GCCTGGGGAGCGGGGCCCGCCGG - Exonic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084385446 11:68840886-68840908 GCTGGGAGCGGCGGGGCCGCGGG - Intronic
1084889275 11:72228746-72228768 AGCCAGAGCGCGGGGGCAGCGGG - Exonic
1084958265 11:72702967-72702989 GCCAGGGGCGTGGGGGCCTCAGG + Exonic
1085082726 11:73647573-73647595 GTCCGGAGGGCGGGGCCCGGGGG + Intronic
1085197941 11:74683556-74683578 GCCTGGGCCGCGGGGGCGGCGGG - Intergenic
1085521992 11:77144467-77144489 GCCCTGAGAGTGGGGGCTGCAGG + Intronic
1088686764 11:112290276-112290298 TCCCGGAGAGGGGGAGCCGCGGG + Intergenic
1090345086 11:126062942-126062964 GCCCGGAGCACGCGAGCAGCGGG + Intronic
1090699061 11:129278887-129278909 GCCCGGCTCGCGGAGGCCGCGGG + Intronic
1090710085 11:129375968-129375990 GCCCGGCCCGCTGGGGCCGCGGG - Exonic
1090799142 11:130159896-130159918 GCCCGCAGGGCGCGGGGCGCGGG - Exonic
1092253431 12:6914130-6914152 GCCAAGACCGCGTGGGCCGCGGG + Exonic
1092881642 12:12891683-12891705 GCCCAGAGCGCTGGGGCCTCCGG + Intronic
1093728705 12:22544204-22544226 GCGCCGAGCGCGGGGCCGGCGGG + Intronic
1094607283 12:31959567-31959589 GCCCGGACCGCGAGTGCCTCTGG - Intronic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1096178682 12:49539143-49539165 GCTGAGAGCGCGGCGGCCGCGGG + Exonic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1096465842 12:51847573-51847595 GCCCGGAGCGCAGGGGTGGGTGG - Intergenic
1096648664 12:53051356-53051378 GCCTGGAGCGTGGGGACAGCAGG + Intronic
1097166666 12:57089722-57089744 GCACGGAGCGCGCGGGCCCCCGG + Intronic
1100869501 12:98895174-98895196 GCGCGGCGCGCGGGGGCTGCAGG + Intronic
1101037190 12:100717334-100717356 TGCCGGCGCGCGGGGGCCCCCGG - Intergenic
1101409554 12:104457313-104457335 GACCGGAGCCCGGGAGGCGCGGG - Exonic
1102933884 12:116881375-116881397 GGCTGGAGCGCGGCGGCAGCGGG - Exonic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1103325317 12:120116535-120116557 GCGCGGCCCGCGGGGGCCTCGGG - Intronic
1103595373 12:122021891-122021913 GCCAGGCGCGCGGCGGCCCCGGG + Exonic
1103899323 12:124295269-124295291 ATCCGGGGCGCGGGGGGCGCCGG + Intronic
1104918263 12:132277653-132277675 GCCAGCAGAGCCGGGGCCGCGGG - Intronic
1104928112 12:132324245-132324267 GCCGGCAGAGTGGGGGCCGCAGG + Intronic
1104940617 12:132392887-132392909 CCCTGGAGCGTGGGGGCCACAGG + Intergenic
1105202762 13:18194236-18194258 GGCCGGGGCGCACGGGCCGCTGG - Intergenic
1105270897 13:18874961-18874983 GCCTGCACCGCGGTGGCCGCCGG + Intergenic
1105327334 13:19382399-19382421 GCCCGCAGCGCGGGGCCCGGAGG + Intergenic
1105964527 13:25372322-25372344 GCCCGGGGCGGGGGCGGCGCGGG + Intronic
1106422544 13:29595695-29595717 GCGCGGAGCGCGAGGGGCGGGGG - Intergenic
1107595647 13:41960804-41960826 GCACGGAGCGCAGGGGCACCAGG + Intronic
1108409685 13:50133623-50133645 GCCCGGAGCAAGGGGCGCGCAGG + Intronic
1112041569 13:95552983-95553005 GGGCTGAGGGCGGGGGCCGCGGG - Intronic
1112290949 13:98143522-98143544 GGCGGGAGGGCGGGGGCCGGCGG + Intronic
1112507149 13:99981963-99981985 GCCTGGAGCCCGGTGGCCGCCGG + Exonic
1112520372 13:100089320-100089342 AACCGGGGCGCGGGGGCAGCCGG - Intronic
1113768364 13:112894387-112894409 GCGCGGAGCTCGGCGGACGCGGG + Intronic
1113849129 13:113407991-113408013 GCTGGAAGCGCGTGGGCCGCTGG + Intergenic
1114620609 14:24094184-24094206 GCCTGGAGCCCCGGGGCCGAGGG + Exonic
1114865999 14:26597152-26597174 GGCAGGGGCGCAGGGGCCGCCGG + Intronic
1115028312 14:28767175-28767197 GAACGGGGCGCGGGGGGCGCGGG - Exonic
1115556151 14:34546502-34546524 GCACGGCGCGCGGAGGCTGCCGG + Intergenic
1115557757 14:34556579-34556601 GCACGGCGCGCGGAGGCTGCCGG - Intergenic
1116821848 14:49634437-49634459 GCCCGGGGCCCGGGGGCTGCCGG + Exonic
1116916620 14:50532207-50532229 GCCGCGAGGGCGCGGGCCGCTGG - Intronic
1116945274 14:50830673-50830695 GCGCGGCTCTCGGGGGCCGCGGG + Intronic
1117131925 14:52695579-52695601 GCCCGGAGGTGGGGCGCCGCTGG - Exonic
1117252925 14:53953660-53953682 CCTGGGAGCGCGGCGGCCGCGGG - Intronic
1117307266 14:54488892-54488914 GCTGGGAGGGCGGGGGCCGGAGG - Intronic
1118463907 14:66013737-66013759 GCGCTGAGGGCGGGGGCGGCGGG + Intergenic
1119438497 14:74612698-74612720 GGCCGGAGCGGGGGTGGCGCGGG + Intergenic
1119744325 14:77033468-77033490 GCCTGGGGCGCGCGGGCAGCCGG + Intergenic
1119877999 14:78076798-78076820 GCCTGGAGAGAGGGGGCCCCGGG - Intergenic
1120167849 14:81220237-81220259 GCCCGGCCCGCGGCGGCCCCAGG + Intronic
1120993602 14:90398268-90398290 CCCTGGTGCGCGGGGGCCGGGGG + Intronic
1121199582 14:92106316-92106338 GCTCCCAGGGCGGGGGCCGCGGG + Intronic
1121377793 14:93430417-93430439 GGCTGGAGCGCCGGGGCCGGAGG - Intronic
1121691027 14:95877088-95877110 ACCCGGAGCGCCGGAGCCGCAGG - Intergenic
1121711018 14:96039313-96039335 GCCCCGAGCGCGGGGGCGGGCGG - Exonic
1122145082 14:99684192-99684214 GCCCGGAGCGCCGGAGCCGGAGG + Intergenic
1122353155 14:101109088-101109110 TCCCGGAGCACGGGGCCCCCTGG + Intergenic
1122486919 14:102087679-102087701 TCCCCGAGCGCGCAGGCCGCGGG - Intronic
1122779124 14:104136272-104136294 GGCCGGAGCGCGGGGGCGCGCGG + Intergenic
1122978565 14:105181093-105181115 GGCGGGGGCGCGGGGGACGCGGG + Intronic
1123004457 14:105314693-105314715 GCCGGGGGCGCGCGGGGCGCGGG + Exonic
1123055429 14:105567049-105567071 GCCCTGAGCGCGGGCTCTGCGGG + Intergenic
1123464708 15:20506458-20506480 GCCCGGAGCGCCGCGGCGGGTGG + Intergenic
1124426965 15:29570691-29570713 ACGCGGCGCTCGGGGGCCGCCGG + Exonic
1126837256 15:52679443-52679465 GCCAGGGCCGCGGAGGCCGCCGG - Intronic
1127674816 15:61228955-61228977 GCCCGGGGCGCGGGGTCCGGCGG - Intronic
1127753591 15:62068504-62068526 GCGCGGTGCCCGGCGGCCGCAGG - Exonic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1128454252 15:67823682-67823704 GAGCAGAGCGCGGGGGCGGCGGG - Intronic
1129607551 15:77032207-77032229 GGCCGGTGGGTGGGGGCCGCTGG + Intronic
1130549504 15:84881019-84881041 GCACGCAGCGCGGTGGCCCCTGG + Intergenic
1131119717 15:89814741-89814763 GGCGGGAGGGCGGGGGCTGCGGG - Intronic
1131144346 15:90001681-90001703 GGCGGGGGCGCGGGGGGCGCGGG + Intronic
1131150646 15:90045513-90045535 GGCCTGAGCCCAGGGGCCGCTGG + Intronic
1131160524 15:90102162-90102184 GCCCGCAGCCCGGGGACGGCGGG - Intronic
1131832212 15:96361210-96361232 GCCGGGGGCGGGGAGGCCGCGGG - Intergenic
1131946399 15:97627017-97627039 GTGGGGAGCGCGGGGGCAGCAGG - Intergenic
1132250654 15:100333334-100333356 GCCCTGAGCCAGGGGGCTGCAGG - Intronic
1132320175 15:100919563-100919585 GCCCGGAGCGCAGGGGCCCGCGG - Intronic
1132398226 15:101489561-101489583 GCGGGGGGCGCGGGGGGCGCCGG - Exonic
1132398230 15:101489570-101489592 GCGGGGGGCGCGGGGGGCGCGGG - Exonic
1132398236 15:101489579-101489601 GCCGCGGGCGCGGGGGGCGCGGG - Exonic
1132548500 16:544471-544493 ACCCGGAGCGTGGAGGCCGCGGG - Intronic
1132552931 16:560717-560739 ACGCGGGGCGCGGGGGCAGCGGG + Intronic
1132585876 16:705584-705606 CGTCGGCGCGCGGGGGCCGCCGG + Exonic
1132588101 16:714994-715016 GGCCGGAGCTCGGGCGCCGCCGG - Intronic
1132630695 16:915847-915869 GGCCGGAGCACGTGGGACGCGGG + Intronic
1132741268 16:1414506-1414528 GCGCGGAGGCCGGGGGGCGCGGG + Intronic
1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG + Intronic
1132968438 16:2673083-2673105 GCGCGGAGGGCGGGGGAGGCCGG - Intergenic
1133038282 16:3046579-3046601 GCCCGGAGAGGAGGGGCCGCTGG + Intergenic
1133097683 16:3458315-3458337 GCCGGGGGCGCGGGCGCGGCCGG - Intronic
1133802182 16:9092507-9092529 GCCCGGAGAGCGGGGACCCTCGG - Intronic
1134014568 16:10879259-10879281 GCCCAGAGCTCCGGGGCCGTGGG + Intronic
1134070055 16:11255360-11255382 CGCGGGCGCGCGGGGGCCGCGGG + Exonic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1135382747 16:22008167-22008189 GAGCGGCGCGCGGGGGCCGAGGG + Intronic
1135775979 16:25257825-25257847 GCGGAGAGCGCGGGGGGCGCTGG + Exonic
1136396654 16:29996168-29996190 CCCCTGAGCGCGGGGTACGCCGG + Exonic
1136428182 16:30183184-30183206 GCGAGGGGCGCGGGGGGCGCGGG - Intronic
1136428195 16:30183211-30183233 GCAGGGGGCGCGGGGGGCGCGGG - Intronic
1136579430 16:31142738-31142760 GCCTGGCCCGCTGGGGCCGCGGG - Exonic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG + Intergenic
1138105870 16:54286929-54286951 GCCCCGCGCGCGGGATCCGCGGG - Intergenic
1138619154 16:58197907-58197929 GCTGGGGGCGCGGGGGGCGCCGG + Exonic
1139390641 16:66604869-66604891 GCGCGGAGCCCGGGGACCGCGGG - Exonic
1139433800 16:66925108-66925130 GCCAGGAGCGCGAGCGCCGTCGG - Exonic
1139778290 16:69330608-69330630 GGCCGCAGCGCGGGGCACGCCGG + Intronic
1141456419 16:84145230-84145252 GACCGGCGCGCTGGGGACGCCGG - Intergenic
1141538379 16:84699672-84699694 CCCCGGAGCCCGGGAGTCGCGGG - Intergenic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142252054 16:88996489-88996511 GCGTGGAGCGGGGGGGCCTCTGG + Intergenic
1142393330 16:89816559-89816581 GCCAGGACCCAGGGGGCCGCCGG - Exonic
1142474545 17:181292-181314 GCCGGGCGCGCGGGGGCGTCCGG + Exonic
1142586704 17:979003-979025 GCCGGGATCCCGGGGGCCGAGGG + Intronic
1142623837 17:1180212-1180234 GCCCGGCGCGGGGGGGACGAGGG - Intronic
1142708401 17:1710283-1710305 GCCGAGAGCGCGGGCGCCGAGGG - Exonic
1142763899 17:2055605-2055627 GCCCGGCCCGCCGGGACCGCAGG + Intronic
1142799719 17:2337571-2337593 GCCGGGAGCGCGGCGGGCGGGGG + Exonic
1143099815 17:4498915-4498937 GGCCGGAGCGCAGGAGCCGACGG + Exonic
1143099837 17:4499006-4499028 GCGGGGGGCGCGGGGGGCGCGGG - Exonic
1143099899 17:4499171-4499193 GCGCGGGGCGCGGGCGGCGCTGG + Exonic
1143393283 17:6573039-6573061 GACAGGAGCGCGGGGGATGCTGG + Intergenic
1143503298 17:7351198-7351220 GCTCGGAGCGCGAGGTCCCCAGG + Intronic
1143635690 17:8162767-8162789 CCCCGGGGCGCGGGGAACGCAGG + Intronic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1144205093 17:12974249-12974271 GGAGAGAGCGCGGGGGCCGCGGG - Exonic
1144828791 17:18120798-18120820 GCCCGGAGCTTGGGGGCCGCGGG - Exonic
1145750148 17:27349517-27349539 CCCCTGAGCGCCGGGGCCACGGG + Intergenic
1145765540 17:27456330-27456352 GCCCCGAGGGCGGAGGCCGGCGG + Intergenic
1146256008 17:31391847-31391869 GCCCGGATGGCGGGCGGCGCGGG + Exonic
1146646586 17:34580760-34580782 GTCCGGAGCCCGGTGGCCGCGGG - Exonic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1147168605 17:38605715-38605737 GCGCGGGGGGCGGGGGCCCCGGG + Exonic
1147168644 17:38605822-38605844 GCCGGGGGCGCGGGCCCCGCCGG + Exonic
1147994714 17:44354420-44354442 GCCCGGGGGGCGAGGGCGGCGGG - Exonic
1147996812 17:44363977-44363999 GCGCAGAGCGCGGGGGCTGCGGG - Intergenic
1148111722 17:45148338-45148360 GCACGGCGCGCGAGGGCGGCGGG + Intergenic
1148323637 17:46771483-46771505 CCCGGGAACGCGGGGGCGGCGGG + Intronic
1148878442 17:50707250-50707272 GCCGGGAGCGCGGGGGAAGGGGG + Intronic
1148929968 17:51120323-51120345 GGCGGCAGGGCGGGGGCCGCGGG - Intronic
1148945597 17:51259894-51259916 GCCCGGGGAGGGGGCGCCGCGGG - Exonic
1149994580 17:61399989-61400011 GCTCTGTGCGCGGGGGCGGCGGG - Exonic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150562059 17:66302778-66302800 GCCGGGTGGGCGGGGGCGGCGGG - Intronic
1150643449 17:66964574-66964596 ACCCGGAGCGCGGCGGCGGCGGG + Intergenic
1150830076 17:68511732-68511754 GCCCGGGGCCCGGGCGGCGCTGG + Intergenic
1151499583 17:74480367-74480389 GCCCGGACCACGTGGGCAGCGGG - Intronic
1152049108 17:77958838-77958860 GGCGGGAGCGCGGCGGGCGCTGG - Intergenic
1152183566 17:78840459-78840481 GCCCGGAGCCCGGGGGACGGCGG + Exonic
1152396554 17:80036588-80036610 GCTGCGAGGGCGGGGGCCGCCGG - Intergenic
1152426430 17:80220790-80220812 GCCCGGAGCGGAGCGGCCGGGGG + Intronic
1152433260 17:80260881-80260903 GCGGCGAGCTCGGGGGCCGCAGG + Exonic
1152595455 17:81235674-81235696 GCCTGGAGCCCGGGGCCCTCTGG + Intronic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152654999 17:81515145-81515167 GCCTGGAGCCCGCGGGGCGCAGG + Intronic
1152663312 17:81552859-81552881 GCCCTGAACGCGGGGGCGGCCGG - Intronic
1152704060 17:81833695-81833717 GCCCTGGGCGCGGGGGCGGGCGG + Exonic
1152710719 17:81869511-81869533 GCCCGGACCCCCGCGGCCGCAGG + Intronic
1152728767 17:81960055-81960077 GCGGGGAGCGCGGGAGGCGCGGG + Intronic
1152795864 17:82305900-82305922 GCCGGGAACGCCAGGGCCGCCGG + Intergenic
1152821586 17:82440282-82440304 GCGCGGAGAGCGGGACCCGCAGG + Intronic
1153006234 18:500666-500688 GCCGGGAGCGCGGGGAGCGCGGG - Exonic
1153201971 18:2656024-2656046 GCCCTGAGCCCGGCGGCGGCAGG + Exonic
1153515271 18:5895725-5895747 GCACGGGGCGCTCGGGCCGCGGG + Intronic
1153794420 18:8609565-8609587 GCGCGGAGCCCACGGGCCGCCGG + Exonic
1154125694 18:11689984-11690006 GCCGGGCCCGCGGGGGCGGCGGG + Intronic
1155257872 18:24014487-24014509 GGCCGGGGCGCGGGGGCTGCAGG + Intronic
1157867157 18:51197106-51197128 GCCCGAAGCGCCGGGGCGCCGGG + Exonic
1160025415 18:75211740-75211762 GCCCGGAGCCCGGAGCCCGCGGG + Intronic
1160204772 18:76823084-76823106 GCCCGGGGCGCGGTATCCGCAGG - Intronic
1160499898 18:79396383-79396405 GCCCGGGCCGTGGGGGGCGCAGG - Intronic
1160631253 18:80247537-80247559 GGGAGGAGCGCGGGGGACGCCGG + Exonic
1160680269 19:408966-408988 GCCCGGTCTGCGGGGACCGCCGG - Intronic
1160831963 19:1108401-1108423 CCCTGGTGCGCGAGGGCCGCAGG + Exonic
1160868597 19:1266907-1266929 GGCCGAGGCGCGGGGGCGGCGGG + Intronic
1160947871 19:1652009-1652031 GGCGGGGGCGCGGGGGGCGCCGG - Intronic
1160967709 19:1753855-1753877 GCCGGGGGCGCGGGCGGCGCGGG + Exonic
1160982789 19:1823868-1823890 GGCTGGAGCTCGGGGGCCGGAGG + Intronic
1161006909 19:1941534-1941556 GTCCGGAGCACGGGGTCGGCAGG - Intronic
1161083186 19:2321653-2321675 GCCGGGGGCGCGGGGGGTGCAGG - Exonic
1161153582 19:2721421-2721443 GGGCGGAGCGCGGGGCCCGGCGG - Intronic
1161306794 19:3573171-3573193 GCCCGGAGCGCTGGGGGGGCCGG - Intronic
1161401322 19:4067199-4067221 CCCCGGGGCGCGGGGGGAGCGGG + Intergenic
1161471259 19:4457709-4457731 GCCCGGCGGCGGGGGGCCGCGGG + Exonic
1161664644 19:5568008-5568030 GGGCGGAGCGCGGGCGCGGCGGG - Intergenic
1162128239 19:8510874-8510896 GGCCCGGCCGCGGGGGCCGCGGG + Exonic
1162416983 19:10544134-10544156 GCCCGGAGGACGCGCGCCGCCGG + Exonic
1162802261 19:13118167-13118189 GCCTGGAGGGCGGGGCCCGAGGG + Intronic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1163423306 19:17227025-17227047 GCACGGAGGGCGGGGGGCGCTGG - Exonic
1163426945 19:17245314-17245336 CCCCGGCGCGCGGGGGGCACGGG + Exonic
1163548311 19:17951913-17951935 GCCCGGAGAGCGGAAGCCCCTGG - Intronic
1163551182 19:17967176-17967198 GCGCGGGGCCCGGGGGCGGCGGG - Intronic
1163632679 19:18425286-18425308 CCCGGGAGGGCGGGGGCAGCGGG - Intronic
1163668220 19:18612932-18612954 GGGCGGAACGCGGGGGGCGCGGG - Exonic
1163708612 19:18832352-18832374 GCCCGGGCCGCCGGGGCCGCCGG - Exonic
1165415549 19:35691346-35691368 GCTCTGAGCGCGGGGTCCACCGG + Intergenic
1165850789 19:38849432-38849454 GCCCAGTGCGCAGGCGCCGCGGG - Intronic
1165851428 19:38852165-38852187 GCCGGGAGCGCGGGGGGTGCGGG - Intronic
1166807281 19:45494815-45494837 GCCCTGGGGGCGGGGGCGGCGGG + Exonic
1166888250 19:45973941-45973963 GCCCGGGGGGCGGCGGGCGCGGG + Intergenic
1167268277 19:48493963-48493985 GGCGGGAGCGCCGGGGCCGGCGG - Exonic
1167359111 19:49020489-49020511 GCCCGGAGCCAGGGTGCCACTGG + Intergenic
1167455653 19:49595783-49595805 GCCAGGAGGAGGGGGGCCGCTGG - Exonic
1167753355 19:51394497-51394519 GCGAGGCGCGCGGGGTCCGCAGG - Intergenic
1167797545 19:51719640-51719662 GGCGGCGGCGCGGGGGCCGCTGG - Exonic
1168076292 19:53982443-53982465 GCCCGGGCCCCCGGGGCCGCCGG - Exonic
1168293866 19:55369618-55369640 GCGGGGGGCGCGGGGGGCGCGGG + Intronic
1168293871 19:55369627-55369649 GCGGGGGGCGCGGGGGGCGCGGG + Intronic
1168311794 19:55464434-55464456 GCCGGGTGCGCCGGGGCTGCAGG + Intergenic
1168351015 19:55675445-55675467 GGGCGGAGCGCGGGGGACGCTGG + Intronic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
924958418 2:11380-11402 GCGCGGAGCGTGGGGGTGGCGGG + Intergenic
927552264 2:24010489-24010511 GCCCAGAGCTCGGGGACCCCGGG - Intronic
927811765 2:26184422-26184444 CCAGCGAGCGCGGGGGCCGCGGG + Exonic
928983195 2:37156857-37156879 GCGCGGGGAGCGGGGGCCGGGGG - Intronic
930700671 2:54456254-54456276 GGCGGGAGCGCGGGGGGCGGGGG - Intergenic
934501179 2:94861568-94861590 GCCCTGAGCGGCGGGGACGCAGG + Intergenic
934566942 2:95346479-95346501 GGCAGGCGCGGGGGGGCCGCAGG + Intronic
934966906 2:98731226-98731248 GCGCGGGGCGCGGGGCCCGCGGG - Intergenic
938073096 2:128318636-128318658 GGCCGGAGCGCGGGCGGCGGCGG - Intergenic
941367016 2:164621538-164621560 GGCCGGTGGGTGGGGGCCGCGGG + Exonic
946354628 2:219177042-219177064 GCGCGGCGCGCGGGGGCCCTAGG + Intronic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
948115910 2:235494268-235494290 GCTCCGAGCGCCGGGGCCGAGGG - Exonic
948893100 2:240916484-240916506 GCGGGGAGCGCAGGGGGCGCGGG - Intergenic
948922449 2:241072026-241072048 GCGCGGGGCTCGTGGGCCGCCGG + Intronic
948963214 2:241356257-241356279 GCGCGCTGCGCGGGGGCTGCCGG + Exonic
949014565 2:241702155-241702177 GCCCGGCGCGCGGGGGGCTGCGG - Intronic
1168753104 20:297662-297684 GCCCGGGGCGAGGAGGCCGACGG + Exonic
1168777746 20:462270-462292 GCCCGGGGGGCAGGGGCAGCTGG - Intronic
1169344979 20:4822745-4822767 GCAGGGTGCGCGGGGGCCGTTGG - Intronic
1169758746 20:9068800-9068822 GCCCGGAGCGGGGGACGCGCAGG + Intronic
1170578549 20:17681766-17681788 CCCCGGACGGCGAGGGCCGCGGG + Intronic
1171012021 20:21514025-21514047 GCTCGGCGCGCGGTGGCGGCTGG + Exonic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1172408210 20:34704562-34704584 GGCCCGGGCGCGGGGGGCGCAGG - Intronic
1172482190 20:35277755-35277777 GCCCAGCCCGTGGGGGCCGCTGG - Intergenic
1172661968 20:36574189-36574211 GCCCGGAGCGGGGGGGCCCTGGG + Intronic
1174263974 20:49318402-49318424 GGCCTGGGAGCGGGGGCCGCTGG + Intergenic
1174452648 20:50629438-50629460 CCCTGGAGCGAGGGGGCAGCAGG + Intronic
1175215330 20:57389421-57389443 GCCGGGAGCCCGGGCGCCTCCGG + Intergenic
1175215799 20:57391296-57391318 CCCGGGCGCGCGGGGACCGCCGG - Intergenic
1175267081 20:57709601-57709623 GCGCGGGGCGCGGGGGGCTCGGG + Exonic
1175561472 20:59933865-59933887 GGCCGAAGCGCGGGGACAGCGGG - Intronic
1175950834 20:62582274-62582296 CCCCGGAGTGCGGGGGCAGGGGG - Intergenic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
1176140195 20:63541605-63541627 GCCCGGCCCTCGGGGGCTGCAGG + Exonic
1176173710 20:63707992-63708014 AAGCGGAGCGCGGAGGCCGCTGG - Exonic
1176173716 20:63708016-63708038 GCTTGGCGCGCGGGGGCAGCCGG - Intronic
1176194566 20:63831285-63831307 GCGCGGGCGGCGGGGGCCGCGGG - Intergenic
1176237967 20:64063089-64063111 GTCCAGAGCGCGGGCGCGGCGGG + Intronic
1176624812 21:9083658-9083680 GCCCTGAGCGGCGGGGACGCAGG - Intergenic
1176715191 21:10343769-10343791 GGCCGGGGCGCACGGGCCGCTGG + Intergenic
1176867927 21:14064017-14064039 GCCTGCACCGCGGTGGCCGCCGG - Intergenic
1178487340 21:33027457-33027479 GCCGGGTGCGCGGTGGCGGCGGG - Exonic
1179243838 21:39613086-39613108 GCGCGGGGCGCGGGGAGCGCTGG + Intronic
1179810059 21:43864867-43864889 GCCGGGACCGCGGGGGGCGCGGG - Intergenic
1179921652 21:44510689-44510711 GCCCGGAGAGCCTGGGCTGCAGG + Intronic
1179989516 21:44939946-44939968 GCCGGGAGCCCCGCGGCCGCCGG - Intergenic
1180219883 21:46351940-46351962 GCCTGGAGAGCTGGGGCCACAGG - Intronic
1180558961 22:16601096-16601118 GCCCGCAGGGCGAGGGCAGCCGG - Intergenic
1180908360 22:19431562-19431584 GGCCGGAGGGCGGGTGGCGCGGG - Exonic
1180910697 22:19447883-19447905 GCGCGGAGGGCCGGGGTCGCAGG + Exonic
1180960681 22:19761034-19761056 GCCCGGGGCGCCGGGGGCGGCGG - Exonic
1181283450 22:21735924-21735946 GCCCGGAGCGCGCGGGGCGGGGG - Intergenic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1182355346 22:29720251-29720273 GCCCGGGGCGCGGGGGCGCTAGG + Exonic
1182355463 22:29720598-29720620 GCCAGGGGCGCGGGGGCGGGGGG + Intronic
1183524752 22:38316737-38316759 GCCGGGAGAGCAGGGGGCGCCGG + Intronic
1183525017 22:38317528-38317550 GCCCCCAGCGCGGAGGGCGCGGG - Intronic
1183720190 22:39557902-39557924 CCCCGGGGCGCGGGGGGCGGCGG - Intergenic
1183903355 22:41022229-41022251 GGCCCGGGCGCGGGAGCCGCGGG - Intergenic
1183912953 22:41092459-41092481 GCGCGGAGCGCGGCGGCAGGAGG + Exonic
1184131609 22:42519794-42519816 CCCGGGAGCGCGGGGGCCGCCGG + Exonic
1184141828 22:42582009-42582031 CCCGGGAGCGCGGGGGTCGCCGG + Intergenic
1184146460 22:42614508-42614530 CCCCGGAACGCGGGGGCCCCAGG + Intronic
1184155078 22:42662181-42662203 GCCCGGGGCGCGGGTCCAGCCGG + Intergenic
1184523560 22:45009121-45009143 GCCCGGGGCGCGGGGGCCCGAGG + Intronic
1184562021 22:45268919-45268941 ACCCGGATCGTGGAGGCCGCGGG + Intergenic
1185387803 22:50544307-50544329 GCTCGGAGCCCAGGGGCTGCGGG + Intergenic
949970000 3:9396754-9396776 GCGCGGGGCGCGGGGGTGGCGGG - Intergenic
950345411 3:12288090-12288112 GCGCGGAGGGCTGGGGCCGAGGG + Intronic
950729831 3:14947774-14947796 GGCGGGAGCCCGGGGGCCGCGGG - Intronic
951543840 3:23806640-23806662 GCGCGGCGCGGGGGGGCCTCGGG + Intronic
952816557 3:37452311-37452333 GCGCCGAGCGCGCGGGCCGCGGG - Exonic
952929292 3:38347051-38347073 GGCAGGGGCGCGGGGGCCCCGGG - Intronic
953099281 3:39809534-39809556 GCCCGGAGCGGGGGAGCCTGCGG - Intronic
953246716 3:41199833-41199855 GCCCGGGGCGCGGAGGGCGGCGG + Intronic
953404652 3:42654464-42654486 GCGCGGCGGGCGGGGGGCGCGGG - Intronic
953705442 3:45226517-45226539 ACCCGGAGCGCGGGGGCGCCCGG - Intergenic
954107280 3:48416117-48416139 GCCCCCAGCTCTGGGGCCGCGGG + Exonic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
955407651 3:58635634-58635656 GGCCGGTGGGCGGGGGCGGCCGG - Intronic
955911582 3:63863983-63864005 ACCGGGAGCGCGGGGAGCGCGGG - Intergenic
961081739 3:124033653-124033675 GCCCGGTGGGCGGAGGGCGCGGG - Intergenic
961182223 3:124886540-124886562 GCCGGGAGCGGGCGGGCTGCTGG - Intronic
961182392 3:124887067-124887089 GGCCGGAGCGCGGGGGCCGAGGG + Exonic
961599839 3:128052233-128052255 GCCTGGCGCGCGGGGCCCGCCGG - Intronic
961827508 3:129606697-129606719 GCCGGGAGCCCGGAGGCGGCGGG + Exonic
963035163 3:141019499-141019521 GCCCGGGCCGCGGGCGCAGCTGG - Intergenic
963673514 3:148280781-148280803 GCCCCGGGCGCGGGGCCGGCTGG + Intergenic
966411856 3:179653165-179653187 AGCCGGAGCGCGGGGTCTGCCGG - Exonic
966696332 3:182793713-182793735 CCGCGGGGCGCGGGGGCCGCGGG - Exonic
966874660 3:184315135-184315157 GCCCGGAGGGCGGGCGGGGCCGG - Intronic
967556297 3:190862918-190862940 ACCCGGAGCGAGAGGGCCGGAGG - Intronic
968230781 3:197003433-197003455 GCCCCGGGCGCCGGGGCCGCTGG + Exonic
968278168 3:197456660-197456682 TCCCGGCTCGCGGCGGCCGCAGG - Intergenic
968323492 3:197791678-197791700 GCCCGGAGGGCTGGCGCCGTCGG - Intronic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968949689 4:3684098-3684120 GCCCGGAGCAGGGGTGCCTCTGG - Intergenic
969053166 4:4386783-4386805 GCCCGGAGCGGGAGGGCTGCGGG - Exonic
969138566 4:5050649-5050671 TCCCGGAGAGCTGGGCCCGCAGG + Intergenic
969426543 4:7127782-7127804 GGCCCGAACGCGGGGGCTGCTGG + Intergenic
969716863 4:8871967-8871989 GCCCCGAGCGCGGCCGCTGCCGG + Intergenic
973551237 4:52038125-52038147 GCCGGGGGTGCGGGGGGCGCGGG - Intronic
974069379 4:57110238-57110260 GGCCGGCTCGCAGGGGCCGCAGG + Exonic
976226397 4:82798273-82798295 GGCCGGGGCGCAGGGGGCGCCGG + Intronic
978159511 4:105529112-105529134 GCCCGGAGGGTGGGGGGCGGGGG + Intergenic
978366629 4:107989809-107989831 GCCGGGGGCGCGCGGGCTGCAGG + Exonic
982460935 4:155667730-155667752 GCGGGGCGCGCCGGGGCCGCTGG + Intronic
984823890 4:183906911-183906933 GCCTGGGGCGCGAAGGCCGCGGG - Exonic
985129320 4:186724750-186724772 GCCCGGAGGGCCGGAGGCGCTGG + Intronic
985542601 5:493815-493837 GCCCGGAGTGGGGGAGCCGTCGG - Intronic
985888862 5:2700420-2700442 GCCCGAAGGGCGGTGGCCACAGG - Intergenic
985896139 5:2751067-2751089 GTTCGGCGGGCGGGGGCCGCCGG - Intronic
990389806 5:55307521-55307543 GCCCGGACCACCGCGGCCGCTGG + Exonic
992837302 5:80654177-80654199 GCCCTGGGCGAGGGCGCCGCAGG + Intronic
993457255 5:88141293-88141315 TCCAGGAGCGCGGGCGCGGCCGG + Intergenic
993901073 5:93584659-93584681 GAACGGAGCGCGGGGGGAGCGGG + Exonic
994197270 5:96935219-96935241 GCCCGGGTCGCGGGCGCCGCAGG - Intronic
996379022 5:122845461-122845483 GCCCAGGGCGCGGGAGCGGCCGG + Exonic
996717757 5:126601243-126601265 GCCCGGGCTGCGGGGGCCGAGGG + Intronic
997647179 5:135489323-135489345 GCCAGGATCGCGGGGCCTGCAGG + Intergenic
998101627 5:139439508-139439530 GCGCGGAGCGCGGGGCACGCTGG + Exonic
998406394 5:141876899-141876921 CCCCGGAGCTCTGGGGCCCCAGG - Intronic
999252320 5:150190216-150190238 AGCCGGTGCGCGGGAGCCGCGGG + Exonic
999374972 5:151080742-151080764 GCCCGGCGCGCGGGGTCCCGGGG - Intronic
1001928720 5:175658079-175658101 GCCCGGAGCGCAGCCGGCGCGGG + Exonic
1002021152 5:176365352-176365374 GGCCGGCGCGCGGGGACCTCCGG - Intergenic
1002098984 5:176848099-176848121 GGCCGCAGCGTGGGGGCTGCTGG - Intronic
1002176604 5:177404452-177404474 GCCCGGAGCCCTGGGGCGGAGGG + Intronic
1002580975 5:180209242-180209264 GCGCGGAGCGGGCGGGGCGCGGG + Intergenic
1002700693 5:181122450-181122472 CCCCGGAGCACGGGGGCCGGCGG - Intergenic
1002722756 5:181273489-181273511 GCCTGCACCGCGGGGGCCGCCGG + Intergenic
1002927249 6:1611577-1611599 GGCGGCGGCGCGGGGGCCGCGGG + Exonic
1002986050 6:2191293-2191315 CCCCTGAGTGCGGGGGCCACGGG + Intronic
1003139147 6:3456732-3456754 GCCCGGGGCGCGGGGTCCGGCGG - Intronic
1003603825 6:7542096-7542118 GCCCGGAGAGCGCGGGCTGCGGG + Intronic
1004043951 6:12009163-12009185 GGGCGGAGGGCCGGGGCCGCGGG + Intronic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1006296129 6:33170881-33170903 GCCCGGAGCTCGGGGACCCCAGG - Exonic
1007320946 6:41028409-41028431 GCCCCGAGCGCGGGGGCGCCCGG - Exonic
1007451300 6:41941710-41941732 GGCCGGAGAGCGCGGGGCGCGGG + Exonic
1007557809 6:42781990-42782012 GGCCGGAGCGCGGGAGCTCCCGG - Intronic
1007630257 6:43269532-43269554 GCCCGGGACGCCGGCGCCGCAGG + Intronic
1010752548 6:79631415-79631437 GCCCGGAGCCCGGGGGGCAAGGG + Exonic
1010980547 6:82364875-82364897 GCCCGGAGGGCGCGAGCCGGCGG - Exonic
1012887213 6:104859685-104859707 GCTCTGGGCGCGGAGGCCGCCGG - Exonic
1013048902 6:106512706-106512728 GGCGGGAGCCCGGGGGCCGCTGG - Exonic
1013119133 6:107125919-107125941 GCCCGGAGGGCAGAGGCCCCTGG - Intergenic
1013272567 6:108558126-108558148 GCCCGGAGCGGCGGGGCTGGGGG - Intergenic
1013272686 6:108558635-108558657 GCCCGGAGCCCGGAGGCGGCTGG + Intergenic
1014137743 6:117907923-117907945 GCGCGGGGGGCGGGGGCTGCGGG + Intronic
1015149107 6:130019310-130019332 GCGGGGGGCGCGGGGGCGGCCGG + Intronic
1016462011 6:144286977-144286999 GCGCGGAGCTCGGGGGAGGCCGG + Intronic
1016990613 6:149925619-149925641 GCCCGGAGCTCGGGGACAGCGGG - Intergenic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1018060903 6:160088948-160088970 GCCCGGGGAGTGGGGGCCTCGGG + Intronic
1019032319 6:169024172-169024194 GCCCGGGGAGGGGTGGCCGCCGG + Intergenic
1019196575 6:170286750-170286772 GCCGGGGGCGCGGGGGAGGCCGG - Intronic
1019305606 7:332982-333004 CCGTGGAGCGCGGGGCCCGCCGG + Intergenic
1019455498 7:1124858-1124880 ACCCGCTGCGCGGGAGCCGCAGG + Intronic
1019486924 7:1293640-1293662 GCCCGGACCCTGGGGGCTGCGGG + Intergenic
1019531302 7:1504699-1504721 TCCCGGAGAGCGGGGGCGGCCGG + Intergenic
1019577974 7:1746649-1746671 GCCCGCAGCACGGCGGCCGCGGG - Exonic
1019662573 7:2232842-2232864 GCCCGGCTCGCGCGGGCGGCGGG - Intronic
1019701449 7:2476530-2476552 GCCCGGAGTGGGGGGGCTGGGGG + Intronic
1019828339 7:3301642-3301664 CCCCTGAGCGCGCGGGCCCCGGG + Exonic
1020023592 7:4883496-4883518 ACCTGGGGCGCGGAGGCCGCGGG - Intronic
1020099973 7:5389123-5389145 GCCCGGGGCGAGGAGGCCTCGGG - Exonic
1020278323 7:6637557-6637579 GCCCGGCGCGGGGAGGCCGCGGG + Intronic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1021717008 7:23469827-23469849 GCCCGGCGCGCTGGGGGAGCGGG - Intronic
1022008868 7:26291925-26291947 GCGGGGAGCGCGGGGAGCGCGGG + Exonic
1022008871 7:26291934-26291956 GCGGGGAGCGCGGGGAGCGCGGG + Exonic
1022485117 7:30771800-30771822 CCCCGGAGCGCGGATGCCCCAGG - Intronic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023810363 7:43906657-43906679 TCCCGGAGCGGGCGGGCGGCCGG - Exonic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1024579848 7:50793028-50793050 GCCCGGGGCGCCGGAGCCCCCGG + Intronic
1025901856 7:65751180-65751202 GGCCGGAGCGCAGGCGGCGCTGG + Intergenic
1027361513 7:77415578-77415600 GTGCGGAGCTCGGGGGCGGCTGG + Intronic
1028417463 7:90595938-90595960 GGGAGGAGCGCGGGGGCGGCCGG + Intronic
1029169004 7:98617765-98617787 GCGCGCGGCGCGGGGGCCACGGG + Exonic
1029223582 7:99009069-99009091 GCCCGGAGCATGGTGCCCGCAGG + Intronic
1029273797 7:99392646-99392668 GCGCGGAGGGCGGGGGCCATTGG - Intronic
1029560482 7:101299840-101299862 TCCCCGCGCGCGGGGGCTGCAGG - Intergenic
1030055841 7:105583161-105583183 GCGCTGAGGGCGGGGGCGGCGGG + Intronic
1030983263 7:116210783-116210805 GCGCGGCGCGCGGCGGCCGGAGG + Intronic
1031051983 7:116953865-116953887 GCTGGGCGCGCGGGGGCGGCCGG + Intronic
1032525688 7:132577052-132577074 GGCCGGGGCTGGGGGGCCGCGGG + Exonic
1033390715 7:140924805-140924827 GCGGGGGGCGCGGGGGGCGCGGG + Intergenic
1034174751 7:149091268-149091290 GCCGGGGGCGCGGAGGCCGTGGG + Intergenic
1034243070 7:149624463-149624485 GCCCGGCACACGGGGGCTGCGGG - Intergenic
1034475131 7:151277161-151277183 GCCCGGAGCGGGGGAGGCGCAGG + Intronic
1034617934 7:152435530-152435552 CGCCGGGGCGCGGAGGCCGCGGG + Intronic
1035254437 7:157617225-157617247 GCGCAGAGCACGGGGGACGCTGG + Exonic
1035254449 7:157617299-157617321 GCGCAGAGCACGGGGGACGCTGG + Exonic
1035260564 7:157659210-157659232 TCCTGGAGAGTGGGGGCCGCAGG - Intronic
1035533945 8:376970-376992 GTCCGGAGGGCGGGGGCTGCGGG + Intergenic
1035709521 8:1701518-1701540 GTCCGGGGCGCGGGGAGCGCGGG - Exonic
1036708034 8:11059612-11059634 GCTGGGGGCGCGGGGGGCGCGGG + Intronic
1039050090 8:33484884-33484906 TCCTGGAGCGCGGGGACCGCGGG - Exonic
1040423410 8:47260963-47260985 GCCCCGAGCGCGGCTGCCGCGGG - Exonic
1041439712 8:57881772-57881794 GCCCGGAGATCGGGGACCCCTGG - Intergenic
1042556055 8:70034701-70034723 GCTCGGAACGCGCGCGCCGCAGG + Intergenic
1045063606 8:98427434-98427456 GCCGGGGACGCGGGGGCTGCAGG + Intronic
1045489072 8:102655696-102655718 GCGCTGAGCGCGGCGGCGGCGGG - Exonic
1046547306 8:115668481-115668503 GCGGGGGGCGCGGGGGGCGCGGG - Intronic
1046661220 8:116950022-116950044 GCTCCGAGTGCGGGGCCCGCGGG + Intergenic
1047239401 8:123072691-123072713 GCCGGGAGCGCTGGGCCTGCCGG + Exonic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049194516 8:141308108-141308130 GCCGGGGCCGCGGGGGCGGCGGG + Intronic
1049218242 8:141417547-141417569 GTCCGGAGGGCAGGAGCCGCCGG - Intronic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049558540 8:143296013-143296035 GCGCAGAGGGCGGGGGCAGCTGG + Exonic
1049683253 8:143929169-143929191 GAGCGCAGCGTGGGGGCCGCAGG + Exonic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1049803110 8:144527245-144527267 GCCGCGAGCGCGGGTGGCGCGGG + Exonic
1053202741 9:36163742-36163764 GGCCGGAGTGAGGGGGCTGCTGG + Exonic
1055266209 9:74498355-74498377 GCCCGGCGCGCAGTGGTCGCCGG + Intronic
1055757850 9:79573454-79573476 GTCCGGGGCGCGGGGGCCTGCGG + Intronic
1057146954 9:92764880-92764902 CTCCGGCGCGCGGGGCCCGCTGG + Intergenic
1057361221 9:94374993-94375015 GCCCGGAGCGGCGGGCTCGCGGG - Intronic
1057490529 9:95516490-95516512 GCTCGGAGCGCGGGTGCCGATGG + Intronic
1057662142 9:97013171-97013193 GCCCGGAGCGGCGGGCTCGCGGG + Intronic
1057883073 9:98807854-98807876 GCCCGGGGCGCGGGGTGCGCGGG - Exonic
1058058544 9:100473228-100473250 GCGCGGCGGGCGGGGGTCGCGGG - Exonic
1058357022 9:104094553-104094575 GCGCGGGGCGCGGGGGCTGTAGG + Intronic
1058866651 9:109167172-109167194 GGCCGCAGCGGGGGCGCCGCGGG + Exonic
1058937207 9:109780281-109780303 GCCGGGAGGGCGGGGGCCAGAGG + Intronic
1060477928 9:123999620-123999642 GCCGGGGACGCGGGGGACGCGGG + Intergenic
1060700534 9:125746733-125746755 GCCCGGTCCGCGGCGGCTGCTGG + Intergenic
1060766601 9:126298651-126298673 GCCCGGAGAGCAGGGGCAGGCGG - Intergenic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061149103 9:128818848-128818870 GCCCGGGCCGCGGGGTCCCCCGG - Exonic
1061181710 9:129028331-129028353 GGGCGGGGCGCGGAGGCCGCGGG + Intergenic
1061232033 9:129320734-129320756 GTCCGCAGCTCGGGGGCGGCGGG + Intergenic
1061497228 9:130981934-130981956 GAGTGGAGGGCGGGGGCCGCAGG - Intergenic
1061580282 9:131531767-131531789 GCACGGAGCGGGGGGGCGGCAGG - Intergenic
1062230769 9:135480236-135480258 TCCAGGAGCGCGGGGCGCGCGGG - Intronic
1062474316 9:136719834-136719856 GCCCGGAGCCCCAGGACCGCAGG - Intronic
1062499121 9:136844814-136844836 GCGCGGAGCGCCGGGTACGCGGG - Exonic
1062579647 9:137223574-137223596 CCCCGGAGCGCGTGGGCTTCTGG + Intergenic
1062600318 9:137316303-137316325 GGCCGGCGCGCGAAGGCCGCGGG - Intronic
1062696342 9:137877994-137878016 GCCCGGGGCGGCGGGGCCGGCGG + Exonic
1203788378 EBV:140766-140788 CCCTGGAGCTCGGGGGCGGCCGG + Intergenic
1185605545 X:1366108-1366130 GCCGGGTGCGCGGGGTGCGCGGG + Intronic
1185605757 X:1366754-1366776 GCCGGGTGCGCGGGGTGCGCGGG + Intronic
1185605815 X:1366934-1366956 GCCGGGTGCGCGGGGTGCGCGGG + Intronic
1185605911 X:1367222-1367244 GCCGGGTGCGCGGGGTGCGCGGG + Intronic
1185605974 X:1367411-1367433 GCCGGGTGCGCGGGGTGCGCGGG + Intronic
1185606007 X:1367510-1367532 GCCGGGTGCGCGGGGTGCGCGGG + Intronic
1185606016 X:1367546-1367568 GCCGGGTGCGCGGGGTGCGCCGG + Intronic
1185819159 X:3185040-3185062 GCCCCGAGGGCGAGGGCTGCTGG + Intergenic
1187281437 X:17860926-17860948 GCCCGGAGGCCGGGGCCGGCTGG - Intronic
1187669850 X:21657280-21657302 GCGCGGGGCGCGGGCCCCGCGGG - Exonic
1189324942 X:40106343-40106365 ACCCGGCGGGCGGGGGGCGCGGG + Intronic
1189325392 X:40108312-40108334 GCCAAGAGAGCGGGGGTCGCCGG - Intronic
1193085773 X:77447067-77447089 GCCCAGTGCGTGGAGGCCGCTGG - Intergenic
1195625219 X:106999925-106999947 GCCCGGCGCGCCAGGGCCGGCGG + Exonic
1197759980 X:130021157-130021179 GCCCAGAGGGCCAGGGCCGCGGG - Intronic
1198466613 X:136909632-136909654 GCCCGGAGAGGGCGGGCCACTGG - Intergenic
1198482355 X:137052602-137052624 GCGGGGAGAGCTGGGGCCGCGGG - Intergenic
1198531290 X:137551107-137551129 GCCGAAAGCGCGGGCGCCGCAGG + Intergenic
1200084831 X:153599022-153599044 GCCTGCAGCGCGGGGCCCGGAGG - Exonic
1200224858 X:154411804-154411826 GCCCGGGGCGCTGGGAGCGCCGG + Exonic
1201161323 Y:11169080-11169102 GCCCTGAGCGGCGGGGACGCAGG - Intergenic