ID: 1048553988

View in Genome Browser
Species Human (GRCh38)
Location 8:135457643-135457665
Sequence CGCCGGCGCTGGGTACTCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048553971_1048553988 13 Left 1048553971 8:135457607-135457629 CCGCTCCTCCTCGGCCCGCGCCC 0: 1
1: 0
2: 14
3: 90
4: 714
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553970_1048553988 14 Left 1048553970 8:135457606-135457628 CCCGCTCCTCCTCGGCCCGCGCC 0: 1
1: 0
2: 9
3: 119
4: 749
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553983_1048553988 -8 Left 1048553983 8:135457628-135457650 CCGGAGCGCGGGGGCCGCCGGCG 0: 1
1: 0
2: 2
3: 30
4: 251
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553973_1048553988 8 Left 1048553973 8:135457612-135457634 CCTCCTCGGCCCGCGCCCGGAGC 0: 1
1: 0
2: 5
3: 29
4: 353
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553968_1048553988 20 Left 1048553968 8:135457600-135457622 CCCGCGCCCGCTCCTCCTCGGCC 0: 1
1: 0
2: 6
3: 68
4: 700
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553965_1048553988 28 Left 1048553965 8:135457592-135457614 CCGCGCCGCCCGCGCCCGCTCCT 0: 1
1: 2
2: 12
3: 106
4: 786
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553979_1048553988 -1 Left 1048553979 8:135457621-135457643 CCCGCGCCCGGAGCGCGGGGGCC 0: 1
1: 1
2: 5
3: 33
4: 294
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553980_1048553988 -2 Left 1048553980 8:135457622-135457644 CCGCGCCCGGAGCGCGGGGGCCG 0: 1
1: 0
2: 3
3: 31
4: 257
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553969_1048553988 19 Left 1048553969 8:135457601-135457623 CCGCGCCCGCTCCTCCTCGGCCC 0: 1
1: 0
2: 7
3: 88
4: 795
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553974_1048553988 5 Left 1048553974 8:135457615-135457637 CCTCGGCCCGCGCCCGGAGCGCG 0: 1
1: 0
2: 3
3: 48
4: 441
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553966_1048553988 23 Left 1048553966 8:135457597-135457619 CCGCCCGCGCCCGCTCCTCCTCG 0: 1
1: 0
2: 10
3: 62
4: 688
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1048553982_1048553988 -7 Left 1048553982 8:135457627-135457649 CCCGGAGCGCGGGGGCCGCCGGC 0: 1
1: 1
2: 3
3: 39
4: 393
Right 1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048553988 Original CRISPR CGCCGGCGCTGGGTACTCGG CGG Exonic
900135853 1:1116640-1116662 CGCCAGTGCTGGGACCTCGGCGG + Intergenic
900641581 1:3690298-3690320 CCCCTGCGCGGGGAACTCGGTGG - Intronic
900650400 1:3727493-3727515 TGCCGGCACTGGGTGCTCTGTGG + Intronic
901109969 1:6785953-6785975 CCCCGGCGCTGGGTCCACGGTGG + Intronic
903233756 1:21936995-21937017 CGCCGGCCCGGGGTCCCCGGCGG + Intronic
915589004 1:156860205-156860227 CGCCCGCGCTGGGTGCCTGGGGG - Intronic
1066135914 10:32446155-32446177 CGCCGGCGGCGGGTGCCCGGCGG + Exonic
1068690150 10:59906283-59906305 CGGCGGCGGTGGGAAGTCGGGGG - Exonic
1069544290 10:69318108-69318130 CACCGGAGCTGGTGACTCGGGGG + Intronic
1074295502 10:112183805-112183827 CCCCGGCGCTGGCTAGCCGGCGG - Intronic
1090751633 11:129750921-129750943 CGCCGGTGCTGGGCAGGCGGCGG + Intergenic
1101150223 12:101877212-101877234 CGCCGGCGGCGGGACCTCGGAGG + Intergenic
1102025970 12:109714498-109714520 CGCCCGCGCTGGGAGCCCGGCGG - Exonic
1114559636 14:23580705-23580727 CGCCGGCGCTGGGCAGTGAGGGG + Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117828557 14:59727553-59727575 CACCGGCCGTGGGTTCTCGGCGG + Exonic
1121314668 14:92953752-92953774 GGCCAGAGCTGGGTACTCAGAGG + Intronic
1121496556 14:94395779-94395801 CGCTGGCTCTGGGTTCTTGGTGG - Intergenic
1127142605 15:55993315-55993337 CGCGGGCGCTGGGGGCTCGCTGG - Intronic
1128161098 15:65423115-65423137 CGCGGGCGCAGGGTCCCCGGCGG - Intergenic
1128622480 15:69161551-69161573 CGCAGGCGCTGGGTCCGCTGAGG + Intronic
1132659545 16:1055271-1055293 GGCCGGCGCTGGCCACTGGGGGG - Intergenic
1132851504 16:2026926-2026948 CGGCGGCGCTGGGCACCCGGCGG - Exonic
1132978305 16:2721267-2721289 CGCCGGGGGTCGGTACTCGCGGG + Intergenic
1133069376 16:3235536-3235558 CGCGGGCGCTGGGTGGGCGGGGG - Intronic
1135480097 16:22814775-22814797 CGCCCGCGCTGGGGCCGCGGAGG - Exonic
1142698940 17:1648244-1648266 GGCCTGCGCTGGGAACTGGGAGG - Intronic
1143510683 17:7393760-7393782 CGCCGGCTCCGGGTACCCAGGGG + Exonic
1144806781 17:17972949-17972971 CTCAAGCGCTGGGAACTCGGCGG - Exonic
1151559827 17:74864277-74864299 CGCCGGCCCTGGCTTCTCTGTGG + Exonic
1151931888 17:77237662-77237684 AGCCAGCGCTGGGAACTCAGTGG - Intergenic
1157338174 18:46756525-46756547 CGCGGGCGCGGGGTACGGGGCGG + Exonic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160592340 18:79951545-79951567 GGGCGGCGCGGGGTCCTCGGGGG - Intronic
1160996258 19:1883445-1883467 CGCTGGTGCTGGGGACTTGGAGG + Intronic
1161219180 19:3110198-3110220 CCACGGCGCCGGCTACTCGGAGG + Exonic
1161226428 19:3148640-3148662 CCACGGCGCCGGCTACTCGGAGG + Exonic
1162099992 19:8333723-8333745 CGCCGTCGCTGGCTACTCCGCGG + Exonic
1163817440 19:19475446-19475468 CTCCGGAGCGGGGTACTCTGTGG + Intronic
1165370243 19:35400944-35400966 CGCCGGTGCTGGGGATTCAGCGG - Intergenic
1165906416 19:39197146-39197168 CGCCGGCTCGGGGAGCTCGGGGG - Exonic
928186452 2:29115419-29115441 CGCACGCGCTGGGGACTCGGTGG - Exonic
935746424 2:106193850-106193872 CCCGGGCGCGGGGGACTCGGCGG - Intronic
941188301 2:162344376-162344398 CGTCCGCGCCTGGTACTCGGCGG + Intronic
946865535 2:224038882-224038904 GGCCGGGGCTGGGTGCTCGCCGG - Intronic
948115806 2:235493934-235493956 CGCCGGCGCTGCGTCCTCCTCGG - Intergenic
1168765812 20:381158-381180 CGACGGGGCGAGGTACTCGGCGG + Exonic
1178871974 21:36385063-36385085 TGCTGGCGCTGGGCACTTGGAGG - Intronic
950515405 3:13461737-13461759 CACCGGCGCTGGGAAGTCTGGGG - Intergenic
956677934 3:71753419-71753441 CGCCCGCGCTGGGGTCACGGTGG - Intronic
968222345 3:196948264-196948286 AGCCGGCGCCGGGTCCACGGTGG - Exonic
968605535 4:1533375-1533397 CGGGGGCTCTGGGTACTCAGAGG + Intergenic
968726337 4:2249613-2249635 TGCAGCCGCTGGGTCCTCGGGGG - Exonic
968904883 4:3446535-3446557 CGCAGGCGCTGGGTCCTCTGTGG - Intronic
969016590 4:4107622-4107644 CGCCGGCGCGGGCTCCTCCGCGG + Intergenic
971043379 4:22778933-22778955 CGCGGGCGCAGGGCACTCGCGGG - Intergenic
1002508724 5:179698892-179698914 CGCCGGCTGTGGCTACTCAGGGG + Exonic
1004627939 6:17393999-17394021 CGCCGGAGCTGGGGAGGCGGGGG - Intronic
1013272561 6:108558118-108558140 CGGCGGGGCTGGGGGCTCGGGGG - Intergenic
1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG + Intergenic
1020272845 7:6607369-6607391 CCCCGGTGCTGGGTGCTGGGCGG + Intronic
1021116885 7:16754185-16754207 CGCCGGCGCCCGGTCCCCGGCGG - Intronic
1024733022 7:52273946-52273968 CGCAGGCGCCCAGTACTCGGCGG + Intergenic
1024964853 7:55015255-55015277 AGCCGGCACTGGGTCCTTGGAGG + Intergenic
1026522991 7:71132433-71132455 CGCCGGCGCCGCGGACTCCGAGG - Exonic
1034129164 7:148699369-148699391 CGACCGGGCTGGGTTCTCGGAGG + Intronic
1035667538 8:1389923-1389945 TGCCGGAGCTGGGTGCTCCGCGG - Intergenic
1037884539 8:22589306-22589328 CGGCCGCGCTGGCGACTCGGCGG + Exonic
1039873684 8:41567662-41567684 CGCGGGGCCAGGGTACTCGGCGG - Intergenic
1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG + Exonic
1049562103 8:143317070-143317092 CGCCGAGGCTGGGTGCTCAGGGG - Intronic
1049803403 8:144528457-144528479 CGCCGGGGCTGGGGACTTGTAGG + Intronic
1057234248 9:93346245-93346267 CGGCGGCGCTGGAGACCCGGCGG + Exonic
1060945743 9:127568717-127568739 CGCCGGGGCCGGGGGCTCGGGGG - Intronic
1061348143 9:130043051-130043073 CGCCGTCGCGGGGATCTCGGGGG - Exonic
1061623006 9:131823948-131823970 CGCCGGCGCCGGGCTCTCCGCGG - Intergenic
1062250919 9:135593001-135593023 CACGGGGGCTGGGGACTCGGGGG + Intergenic
1062250926 9:135593016-135593038 CTCGGGGGCTGGGGACTCGGGGG + Intergenic
1197708027 X:129647884-129647906 CGCCGGGGGTGGGCACTTGGGGG + Exonic
1201291190 Y:12421581-12421603 AGCCGGCGCTGGGGGCCCGGAGG + Intergenic
1201857762 Y:18564319-18564341 TGCCAGCGCTGGTTACTGGGTGG - Intronic
1201875559 Y:18756062-18756084 TGCCAGCGCTGGTTACTGGGTGG + Intronic