ID: 1048557830

View in Genome Browser
Species Human (GRCh38)
Location 8:135498018-135498040
Sequence GCCACCAACCTAGGTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048557830_1048557835 19 Left 1048557830 8:135498018-135498040 CCCTGTGAACCTAGGTTGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1048557835 8:135498060-135498082 GTTCATTAAAGGATGATGCATGG No data
1048557830_1048557834 8 Left 1048557830 8:135498018-135498040 CCCTGTGAACCTAGGTTGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1048557834 8:135498049-135498071 TAAGCTAATGTGTTCATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048557830 Original CRISPR GCCACCAACCTAGGTTCACA GGG (reversed) Intronic
905883611 1:41479955-41479977 GCCACCCAGCCAGGTTCAAAGGG - Intronic
911192364 1:94960546-94960568 GCAACCAAGCTATGTCCACATGG - Intergenic
912480330 1:109978032-109978054 GCAACCAACCTGGATTCCCAAGG - Intergenic
919776990 1:201200572-201200594 GACACCAACCTGGGATCCCAGGG - Intronic
921049906 1:211503921-211503943 GACACAAACCTAGAATCACACGG - Intergenic
924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG + Intergenic
1062989328 10:1800688-1800710 GCCACACACCTAGGAGCACACGG + Intergenic
1069373066 10:67767334-67767356 GCCTCACACCTAGGTTCAAAAGG - Intergenic
1072752647 10:97994245-97994267 TTCACAAACCTAGGTTAACATGG + Intronic
1075191170 10:120310116-120310138 ACCACCATCCTGGGTGCACAAGG + Intergenic
1079078922 11:17400479-17400501 GGCTCCAACCTGGGTTTACATGG - Intronic
1085242257 11:75067623-75067645 ACCAGCAACTCAGGTTCACAGGG + Intergenic
1087829208 11:102800566-102800588 GCAGCCAGCCTAGATTCACATGG + Intergenic
1088917366 11:114237923-114237945 TCCACCAACCAAGGCTCCCAGGG - Intronic
1096246378 12:49990299-49990321 GCCACTAACCTAGGACGACAAGG - Exonic
1108684672 13:52808297-52808319 GTCACCTATCCAGGTTCACACGG - Intergenic
1111317622 13:86582686-86582708 TCCACCAACCAAGGTTGACCTGG + Intergenic
1113664894 13:112134637-112134659 GCCACCAGCCCAGGTTCATGAGG + Intergenic
1117890598 14:60417806-60417828 GCCAGGAACCTAGGTTTGCAGGG - Intronic
1127711575 15:61604415-61604437 GCCACCTGCCTTGATTCACAAGG + Intergenic
1129209655 15:74060318-74060340 GCCACCACCACAGGTGCACAGGG - Intergenic
1132206556 15:99989808-99989830 TCCACCACCCAATGTTCACACGG - Intronic
1136065646 16:27756464-27756486 GTCACCTACCTAAGGTCACACGG + Intronic
1138392592 16:56681549-56681571 GCCACCAGCCCAGGGTCAGAGGG - Intronic
1139935935 16:70571190-70571212 TCCCCCAACCTACCTTCACAGGG - Exonic
1142213808 16:88821264-88821286 GCCACCAGCCTCGGCTCACCTGG - Intronic
1143863546 17:9908171-9908193 GTCACCAGCCTGGGGTCACATGG + Intergenic
1144088503 17:11832171-11832193 TCCCCCAACCAAGCTTCACAAGG - Intronic
1144624878 17:16839508-16839530 CCCACCAACCCAGGCTCAGAGGG + Intergenic
1144881552 17:18433213-18433235 CCCACCAACCCAGGCTCAGAGGG - Intergenic
1145060252 17:19728711-19728733 GCCAGCCACCCACGTTCACATGG + Intergenic
1145150681 17:20511173-20511195 CCCACCAACCCAGGCTCAGAGGG + Intergenic
1146675833 17:34773321-34773343 GCCACCACCCTGGGTTCAGCAGG - Intergenic
1147579023 17:41618203-41618225 CCCACCAACCCAGGCTCAGAGGG + Intergenic
1148511515 17:48174424-48174446 GACACCTCCCTAGGTTCAGAGGG + Intronic
1149535522 17:57430756-57430778 GCCACCATCCTTGGGTCAGAGGG - Intronic
1150007170 17:61477055-61477077 GCCACCCTTCTAGGTTCCCAGGG - Intronic
1151231760 17:72690124-72690146 GCCACCAGCCTGGGTACAGATGG - Intronic
1153943583 18:9997794-9997816 GCCTGAAGCCTAGGTTCACAGGG - Intergenic
1155086663 18:22465609-22465631 GCCACTGACCTGGGTCCACATGG + Intergenic
1164094598 19:21995537-21995559 ACCATCAGCCCAGGTTCACAGGG - Intronic
1165859227 19:38898516-38898538 CCCACCAACCTAGTTACACTGGG + Intronic
1166891196 19:45994860-45994882 GCCACTAGCCCGGGTTCACACGG - Intergenic
1168189641 19:54728316-54728338 GCCACCAGCCTGGGGCCACATGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
928742289 2:34369350-34369372 GCAAACAACCTAGGTTCGCCAGG - Intergenic
932470462 2:71951820-71951842 GCCACCAGCCTGGGTCCCCAAGG + Intergenic
934514506 2:94977795-94977817 GCCACCAACCTCTGTGCCCATGG + Intergenic
939666864 2:144963412-144963434 GCCACAAGCCAAGGTTCAGATGG + Intergenic
940916969 2:159266746-159266768 AACACCATCCTAGGTTCTCAGGG + Intronic
942877209 2:180815105-180815127 GCCACAAACCAAGGAACACATGG + Intergenic
944078689 2:195760126-195760148 GCCATCATCACAGGTTCACAGGG - Intronic
946631011 2:221669132-221669154 GCCACTCTCCTAGCTTCACAGGG + Intergenic
947791800 2:232872962-232872984 GGCACCAGCCTAGGTTGGCAGGG + Intronic
1172647796 20:36482259-36482281 GCCAGCAATCGAGGTGCACAGGG + Intronic
1175844895 20:62053011-62053033 GCCACCTGCCTTGGGTCACATGG - Intronic
1178480046 21:32971801-32971823 GCCATAAACCTAGGTACAGAGGG - Intergenic
1181003330 22:19998196-19998218 GCCACCAGCCTGAGTGCACAGGG + Intronic
951025610 3:17825528-17825550 GCCAGCAACCTAGTCTGACACGG + Intronic
951561210 3:23968569-23968591 GACACCACACTAGGCTCACATGG - Intronic
951786617 3:26427145-26427167 GCTACCAAGCTGGGTTCTCATGG - Intergenic
952510839 3:34053306-34053328 CCCACCAACATAGGTTCCCCAGG - Intergenic
953854378 3:46489551-46489573 GCCACCAGCCCAGGGGCACAGGG - Intergenic
955443641 3:58983843-58983865 GTAACCTACCTAGGATCACATGG + Intronic
958034730 3:88156285-88156307 AGCCCCAACCTAGATTCACATGG + Exonic
960702799 3:120453189-120453211 GGCAGAAACCTAGGTTCAGAGGG - Intergenic
968870246 4:3238463-3238485 GCCACCACTCTGGCTTCACAAGG - Exonic
969247714 4:5946117-5946139 GTGACCACCCTAGGTTCAGAGGG - Intronic
969760031 4:9174895-9174917 GCCACCAACCTGCCTTCAGAAGG + Intronic
969829733 4:9785423-9785445 TCCACCAAACAAGGTTCACGAGG - Intronic
970303091 4:14702304-14702326 GCCCCCAACCTAGGGTTTCATGG + Intergenic
973202686 4:47522102-47522124 GCCACCAACAAAAGTTAACAAGG - Intronic
974011178 4:56608725-56608747 TCTACCAACCTGGGGTCACAAGG - Intergenic
984137784 4:175962431-175962453 GCCACCAACCTAGGACAATAAGG + Intronic
984950320 4:185003193-185003215 GCCACCACACTAGGTTCTGAGGG + Intergenic
986667693 5:10117562-10117584 GTAACCAAACTAGGCTCACATGG + Intergenic
992660688 5:78957889-78957911 GCCACCAGCCAAGGTCCAGATGG + Intronic
997416978 5:133736565-133736587 GCCACCAACCTGGATGCACAAGG + Intergenic
997819623 5:137053221-137053243 GCAACAAACCAAGGTGCACAGGG + Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
999759570 5:154690136-154690158 ACCACTAACCTAGATTCACAAGG - Intergenic
1000225435 5:159256532-159256554 CCCACCAACCTAGGTTGTCAAGG + Intergenic
1001243373 5:170087055-170087077 GCAGCCAACTTAGGTTCACATGG - Intergenic
1003340230 6:5213527-5213549 CCCACCCACCCAGGTGCACATGG - Intronic
1008597752 6:53060361-53060383 GAAACCAATCTAGGTTCAGATGG - Intronic
1010010224 6:71040371-71040393 GGCACCCTCCTGGGTTCACATGG + Intergenic
1013881399 6:114906122-114906144 GCCAGCAACCTGGGTACAAATGG + Intergenic
1018896834 6:168025278-168025300 GCCTCCAACCGAGGGACACAGGG - Intronic
1021998672 7:26203427-26203449 TGCTCCAACCTAGGTGCACAAGG - Intronic
1025238365 7:57250615-57250637 GCCATCAACCCAGGGTCACTGGG - Intergenic
1036197555 8:6733575-6733597 GACACCAAGCTTGGTTCTCAAGG - Intronic
1043889327 8:85639202-85639224 CCCACCAACCTAGGCAAACAGGG - Intergenic
1048557830 8:135498018-135498040 GCCACCAACCTAGGTTCACAGGG - Intronic
1048798882 8:138177894-138177916 GCCACCAGCTTAGGTACATATGG - Intronic
1058274370 9:103021826-103021848 GCCACCATGCTAGCCTCACATGG + Intergenic
1061082791 9:128382248-128382270 GTCACCAACCTAGGTTACCATGG - Intronic
1192080839 X:68046521-68046543 GCCACCTTCCTAAGTCCACATGG + Exonic
1193388245 X:80895512-80895534 GCCACAACCCTGGCTTCACAGGG - Intergenic
1195818863 X:108920214-108920236 GCCATGAACTTAGGTTAACATGG - Intergenic
1202042689 Y:20701649-20701671 ACCACCAACACAGGTCCACATGG - Intergenic