ID: 1048558354

View in Genome Browser
Species Human (GRCh38)
Location 8:135505358-135505380
Sequence CCACAAGCAGGGCAGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 1, 2: 5, 3: 71, 4: 656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558354_1048558364 9 Left 1048558354 8:135505358-135505380 CCACTTCCCTGCCCTGCTTGTGG 0: 1
1: 1
2: 5
3: 71
4: 656
Right 1048558364 8:135505390-135505412 ACCCTTGAGAGCTCTCCTTCAGG No data
1048558354_1048558366 10 Left 1048558354 8:135505358-135505380 CCACTTCCCTGCCCTGCTTGTGG 0: 1
1: 1
2: 5
3: 71
4: 656
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558354_1048558369 26 Left 1048558354 8:135505358-135505380 CCACTTCCCTGCCCTGCTTGTGG 0: 1
1: 1
2: 5
3: 71
4: 656
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558354 Original CRISPR CCACAAGCAGGGCAGGGAAG TGG (reversed) Intronic
900092729 1:927461-927483 CCTCACGCAGGGCAGGGACCTGG - Intronic
900166015 1:1244661-1244683 CCACCAGCAGGGCAGGCATGCGG + Intronic
900866879 1:5275237-5275259 TCACTCGCAGGCCAGGGAAGAGG + Intergenic
901200094 1:7461941-7461963 CCTTAGGCAGGGCAGGGAAGGGG - Intronic
901332333 1:8420456-8420478 CCACAGGGAGGGGAGGGCAGAGG - Intronic
901388921 1:8929939-8929961 CCACAAGAGGGGCTGGGAAGGGG + Intergenic
901551052 1:9996667-9996689 CCACATTCAAGGTAGGGAAGAGG - Intergenic
901657226 1:10776448-10776470 TTACAAGCAGGGGAGAGAAGTGG - Intronic
901973712 1:12928188-12928210 CCACAGGAAGGGCAGGGAGTGGG - Intronic
901977012 1:12953132-12953154 CCACAGGAAGGGCAGGGGACGGG + Intronic
902008157 1:13248638-13248660 CCACAGGAAGGGCAGGGGACGGG - Intergenic
902011466 1:13273579-13273601 CCACAGGAAGGGCAGGGAGTGGG + Intergenic
902027133 1:13392437-13392459 CCACAGGAAGGGCAGGGGATGGG - Exonic
902779529 1:18695625-18695647 CCACATGAAGGGCAGCCAAGGGG + Intronic
902793340 1:18784155-18784177 CCCCAAGCAGGAAAGGGAAGCGG + Intergenic
903070895 1:20726613-20726635 CCTGCAGCAGGGCAGGGAGGAGG + Intronic
903223942 1:21884613-21884635 GCAGAAGCAGGGCAGGCAGGCGG + Exonic
903295259 1:22339499-22339521 CCAGCAGCAGGGCAGGGCGGGGG + Intergenic
903598651 1:24516806-24516828 CCCCAAGCGGAGCAGGGAAGGGG + Intronic
903875935 1:26472928-26472950 CCGCAGGGAGGGGAGGGAAGGGG - Intronic
903910242 1:26719127-26719149 CCAAAAGCAGGAAAGGAAAGGGG - Intronic
903959297 1:27046702-27046724 CCAAAGGCAGGGCAGGGGTGGGG - Intergenic
904155295 1:28478054-28478076 CCAGAGGCAGGGAAGGGTAGAGG - Intronic
904216133 1:28921418-28921440 CCAAAAACTGGGGAGGGAAGGGG - Intronic
904288451 1:29468792-29468814 CCACAAGCAGGACTGGCAGGGGG - Intergenic
904474787 1:30757795-30757817 CCTGGAGCAGGGCAGAGAAGGGG + Exonic
905804325 1:40864759-40864781 CAACAAGCAGGCCAGGTGAGTGG + Intergenic
905816472 1:40954794-40954816 GGGGAAGCAGGGCAGGGAAGAGG + Intergenic
905832765 1:41086553-41086575 CCAGGGGCAGGGCAGGGCAGGGG - Intronic
906037020 1:42757076-42757098 CCATAAGGAAGGCAGGGAAAAGG + Intronic
906364090 1:45190794-45190816 ACAGAAGCAGGACTGGGAAGAGG + Intronic
906849212 1:49229794-49229816 CCAACACCAGGGCTGGGAAGAGG + Intronic
906871419 1:49485810-49485832 CCACAGGCTGGGAAGGGTAGTGG + Intronic
907043918 1:51288058-51288080 CCAAAGGCAGGGCAGGGCAGGGG + Exonic
907240266 1:53077340-53077362 CCTCAAGGTGGGCAGGGGAGGGG + Exonic
907542161 1:55225527-55225549 TCTCTAGCAGGGCAGGGCAGAGG + Intergenic
908788616 1:67758875-67758897 CCAGAGGCTGGGAAGGGAAGGGG + Intronic
909037064 1:70605477-70605499 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
909579732 1:77220930-77220952 CCATAAGCAGGATAGGGAATAGG + Intergenic
909582922 1:77258340-77258362 CCAGAGGCTGGGAAGGGAAGGGG + Intergenic
910804298 1:91175157-91175179 CCACTAGCAATCCAGGGAAGAGG + Intergenic
911961422 1:104307910-104307932 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
911973928 1:104467623-104467645 CCACAAAGAGGGAAGGGAAAAGG + Intergenic
912168780 1:107071886-107071908 CCCTATGCAGGGCAGAGAAGTGG - Intergenic
912631962 1:111254143-111254165 ACAAAAGCAGGGCAGGGAGCTGG + Intergenic
913317631 1:117566044-117566066 GCTCAGGCAGGCCAGGGAAGGGG + Intergenic
914033027 1:143975412-143975434 CCCCAAGCCGGGCAGGGTGGGGG + Intergenic
914156418 1:145092554-145092576 CCCCAAGCCGGGCAGGGTGGGGG - Intronic
914755089 1:150557916-150557938 GCACCAGCAGGGCAGGGAAGAGG - Intronic
915099397 1:153488091-153488113 CCAGAGGCTGGGAAGGGAAGAGG + Intergenic
915105070 1:153529144-153529166 CCACAGGCTGGGAAGGGTAGAGG + Intergenic
915669055 1:157472100-157472122 TCCCAAGCAGAGCAGGGAATTGG - Intergenic
915684075 1:157613603-157613625 CCAGAAGCTGGGAAAGGAAGGGG + Intergenic
916733692 1:167588555-167588577 CCAGAAGCTGGGAAAGGAAGTGG + Intergenic
918231851 1:182541247-182541269 CCAGAAGCTGGGAAGGGTAGGGG - Intronic
918472265 1:184886267-184886289 CCACACTCAGGGTAGGGAGGCGG + Intronic
919034500 1:192289275-192289297 CCAGAGGCTGGGAAGGGAAGGGG + Intergenic
919835942 1:201573464-201573486 GCAGAGGCAGGGCAGGGCAGGGG - Intergenic
919882107 1:201907594-201907616 CTACAAGCTGGGAAGGGATGAGG + Intronic
920111288 1:203589025-203589047 AGACAAGGATGGCAGGGAAGTGG + Intergenic
920441058 1:205980672-205980694 CCACATCCAGTGGAGGGAAGTGG - Intronic
920820819 1:209379157-209379179 CTACAAGGAGGGCAGGGCTGTGG - Intergenic
921163750 1:212491192-212491214 CCGGAAGCAGGGCAAGGCAGGGG - Intergenic
922180895 1:223231815-223231837 GCTCCAGCAGTGCAGGGAAGGGG - Intronic
922319300 1:224471402-224471424 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
922392592 1:225161169-225161191 CCAGAGGCTGGGCAGGGTAGTGG - Intronic
922620633 1:226986007-226986029 CCGCCAGCAGAGCAGGGGAGAGG - Intronic
922773535 1:228203778-228203800 CCAGAGGCTGGGGAGGGAAGCGG + Exonic
923658739 1:235940574-235940596 CCATAAGTAGGGCAGGGAAGTGG - Intergenic
923669711 1:236029932-236029954 CCACACGCAGAGGAGAGAAGAGG + Intronic
923790656 1:237108297-237108319 TCAGAAGCTGGGCAGGAAAGGGG - Intronic
924316077 1:242798017-242798039 CAACTGGCAGGGCAGGGAGGTGG + Intergenic
924549126 1:245057945-245057967 CCAGAGGCTGGGAAGGGAAGAGG - Intronic
924814856 1:247432619-247432641 ACACAAACAGGGAAGGGTAGGGG + Intronic
1063381607 10:5589357-5589379 CCAGAAGCAGGGCTGGGAATTGG - Intergenic
1063546507 10:6987062-6987084 CCCCAAGCAGACCAGTGAAGTGG + Intergenic
1063613483 10:7582829-7582851 CCAGAGGCTGGGCAGGGTAGTGG + Intronic
1063621787 10:7656186-7656208 CCACATGCCGGGGAGGGATGCGG + Intronic
1063636496 10:7787819-7787841 CCAGAAGCAGTGCCGGGACGAGG - Exonic
1063713762 10:8506865-8506887 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
1064969666 10:21051997-21052019 CCAAAAGGAGAGCAGAGAAGGGG + Intronic
1065045817 10:21746981-21747003 CAAAAAGCAGGCCAGAGAAGAGG - Intergenic
1065887047 10:30087750-30087772 GAAAAAGCAGGGCGGGGAAGTGG + Intronic
1066323425 10:34328365-34328387 CCAGAAGTAGGGCAGTGAGGGGG + Intronic
1066326064 10:34359742-34359764 CCACAAACAGGGGAGGGGAGGGG + Intronic
1066390042 10:34971151-34971173 CCACAAAGAGGCAAGGGAAGGGG + Intergenic
1067703364 10:48589324-48589346 CCAGAAGCAGGCTGGGGAAGCGG - Intronic
1068926483 10:62544851-62544873 CCATAAGCATGGGAGGGAAAAGG + Intronic
1069395634 10:67984485-67984507 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
1069680982 10:70284920-70284942 CCAGAAGCAGGGAAGGGTAGTGG + Intergenic
1069718397 10:70535007-70535029 CCACAGGAAGGACAAGGAAGAGG + Intronic
1069793715 10:71039599-71039621 ACCCAGGCAGGGGAGGGAAGGGG + Intergenic
1069857397 10:71448875-71448897 CCACCAGCAGGCCAGGGAGAGGG + Intronic
1069938964 10:71940384-71940406 CCACAAAGAGGGAAGGGGAGAGG - Intergenic
1070556962 10:77535873-77535895 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
1070963090 10:80512581-80512603 CCAGAAAAAGGACAGGGAAGAGG - Intronic
1071064926 10:81620227-81620249 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
1071113371 10:82189113-82189135 CCAGAGGCTGGGAAGGGAAGTGG - Intronic
1071727054 10:88209467-88209489 CAACCAGCAGGGCTAGGAAGAGG + Intergenic
1072365438 10:94704017-94704039 ACAGAAGCAGGGTAGGGAATTGG - Intronic
1072879012 10:99205084-99205106 CCAAAAGCAGGGAAGGTAGGAGG + Intronic
1073313834 10:102564109-102564131 TCACCTGCAGGGCAGGGAAGAGG - Intronic
1073323196 10:102628035-102628057 CCACAGGCAGGGCAGGGCCCAGG - Intronic
1073327158 10:102649735-102649757 CCACAAGCTGCAGAGGGAAGGGG - Intronic
1074188782 10:111117906-111117928 GCATAAGCTGGCCAGGGAAGTGG - Intergenic
1074735876 10:116431998-116432020 CCTAAAGCAGGGAAGGGATGAGG - Intronic
1075090438 10:119441320-119441342 CCATAGGCAGGGAAGGGAAGGGG + Intronic
1075642369 10:124074005-124074027 GCACACACAGGGCAGGGGAGAGG + Intronic
1075856561 10:125635013-125635035 CCTTAAGCAAGGCAGGGAAAGGG + Intronic
1075941670 10:126395359-126395381 CCACATGCAGGGCTTGGGAGCGG - Intergenic
1076567747 10:131410494-131410516 TTCCACGCAGGGCAGGGAAGGGG + Intergenic
1077092703 11:786910-786932 CCACAGGAAGGCCAGGGAGGAGG + Intergenic
1077139864 11:1019560-1019582 CCAGAAGCAGGGCAGGGGGCTGG - Intronic
1077514483 11:2993085-2993107 CCTGAAGCAGAGCAGGGCAGAGG + Intergenic
1077517029 11:3008182-3008204 CCAAAGGCAGGGCAGGCAGGAGG - Intronic
1077537923 11:3133410-3133432 CCGCAGGCAGTGCAGGGCAGTGG - Intronic
1077888392 11:6402474-6402496 CCACAAGCAGGCTGGGGAAGGGG - Intronic
1078550370 11:12276058-12276080 CCACTCGGAGGGCAGGGGAGAGG - Intronic
1078664281 11:13311481-13311503 TCACAAGAGGGGAAGGGAAGAGG + Intronic
1078665481 11:13321509-13321531 CCCCAAGCAAGGCAGCAAAGAGG - Intronic
1079092785 11:17492809-17492831 CCAGAATCATGGCAGGGGAGAGG - Intergenic
1079316239 11:19410100-19410122 CCTGAAGCAGGGCAGGAAATGGG - Intronic
1079517391 11:21285085-21285107 TCACAAGCAGGGCAGGGTGGGGG + Intronic
1079625363 11:22610771-22610793 CCAGAGGCTGGGAAGGGAAGTGG - Intergenic
1079837198 11:25350048-25350070 TGACAAGCAGGGCAGGGCAGAGG + Intergenic
1080027313 11:27628138-27628160 CCACAAGGAGGAAATGGAAGTGG + Intergenic
1080573272 11:33576422-33576444 CCACAGGGAGGGAAGGGGAGAGG - Intronic
1081028406 11:38045526-38045548 CCACTGGAAGGGCAGGGATGTGG + Intergenic
1081231988 11:40596608-40596630 CCAGAAGCTGGGAAGGGGAGTGG - Intronic
1081587900 11:44399843-44399865 CCACCAGCAGAACAAGGAAGTGG - Intergenic
1081860605 11:46331517-46331539 CCATAGGCAGGACAGGGAAGGGG + Intergenic
1082009224 11:47439005-47439027 CCATCAGCAAGACAGGGAAGTGG - Intronic
1082219048 11:49610364-49610386 CCAGAGGCTGGGAAGGGAAGTGG - Intergenic
1083325772 11:61872250-61872272 TCACAGGCTGGGCAGGGAAGGGG + Intergenic
1083620720 11:64048115-64048137 CCAGAAGCAGGGCCGGGCAGGGG + Intronic
1083622090 11:64054153-64054175 CCAGGGTCAGGGCAGGGAAGCGG + Intronic
1083653687 11:64219139-64219161 CAGCAAGGAGGGCAGGGCAGAGG + Intronic
1083850572 11:65363956-65363978 CCACATGCAGAGCAAGGCAGGGG + Intergenic
1083977985 11:66139499-66139521 CCACAGGCTGGGAAGGGTAGTGG - Intronic
1084463699 11:69310036-69310058 CCACAAGCAGAGCTGGGAGAAGG - Intronic
1084690373 11:70721677-70721699 CCACAGGCAGGGCTGGGATGTGG + Intronic
1084923924 11:72496270-72496292 CCAGAGGCTGGGAAGGGAAGGGG + Intergenic
1085056746 11:73409054-73409076 GGTCAAGCAGGGCAGGGATGTGG - Intronic
1085123100 11:73980016-73980038 CCACAAGACAGGCAGGGATGAGG + Intronic
1086217281 11:84399201-84399223 ACACTAGCAGGGTAGTGAAGAGG - Intronic
1086630603 11:89014510-89014532 CCAGAGGCTGGGAAGGGAAGTGG + Intronic
1088157321 11:106823240-106823262 CCAAAAGCAGGGAAGGCAGGAGG - Intronic
1088361491 11:108994646-108994668 CCAGAGGCTGGGCAGGGTAGTGG - Intergenic
1088463670 11:110110512-110110534 CCATAAGCAGGACAGGAAAGAGG - Intronic
1089260375 11:117220084-117220106 CCAATAGCAGGGCAGGGCAAAGG + Intronic
1089302091 11:117504877-117504899 CTCCAAGAAGGGCAGGGACGGGG - Intronic
1089494796 11:118902599-118902621 CCCCCAGCAGGGCAGGGCCGGGG + Exonic
1089626752 11:119755779-119755801 CACCAGGCAGGGCAGGGAACAGG - Intergenic
1090321817 11:125851557-125851579 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
1090442791 11:126738026-126738048 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
1091045047 11:132317886-132317908 CCCCCAGGAGGGCTGGGAAGGGG + Intronic
1091337687 11:134784711-134784733 CCACAAGGAAGGCAGAGAGGAGG - Intergenic
1091348055 11:134868535-134868557 CCACACACAGGCCTGGGAAGGGG - Intergenic
1091397666 12:163598-163620 CCACCAGCAGGTCATTGAAGAGG - Exonic
1092415658 12:8288671-8288693 CCACAAAGAGGCAAGGGAAGGGG - Intergenic
1093549675 12:20392959-20392981 CCAGAGGCTGGGAAGGGAAGAGG + Intronic
1094283887 12:28770634-28770656 CCACTACCAGGGCTGGGAACAGG - Intergenic
1094323112 12:29206933-29206955 CCACCAGCCGGGCACAGAAGAGG + Intronic
1095134281 12:38579668-38579690 CCAGAGGCTGGGAAGGGAAGTGG + Intergenic
1095365074 12:41393778-41393800 CACCAAGCATGGCAGTGAAGTGG - Intronic
1095807385 12:46334904-46334926 CCAGAAGCTGGGAAGGGTAGGGG - Intergenic
1095946416 12:47756308-47756330 CCACAAGCTGGGAAGGGGACAGG + Intronic
1096214796 12:49792980-49793002 CCACAGGCTGGGGAGGGGAGGGG + Exonic
1096598628 12:52714221-52714243 TCAGAAGCAGCGGAGGGAAGGGG + Intergenic
1096746061 12:53727576-53727598 GCGCAAGGAGGGCGGGGAAGAGG + Intronic
1096975588 12:55697726-55697748 CCACCAGCAGGTCAGGGTATTGG + Exonic
1097283489 12:57860340-57860362 CCAGAAGGAGGGCAGTGAAGTGG + Intergenic
1097690409 12:62729298-62729320 CCACAGCAAAGGCAGGGAAGTGG + Intronic
1099681712 12:85837241-85837263 CCAGAAGCAGGGCAGAGGAATGG + Intergenic
1099723442 12:86394131-86394153 CCAAAAGGATGGCAGAGAAGAGG + Intronic
1100895873 12:99181961-99181983 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
1101089742 12:101272977-101272999 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1101335707 12:103794768-103794790 CCACCAGCAGGGCAACGAACTGG + Intronic
1101665094 12:106805595-106805617 CCAGAAGCAGGGCAGTTAAGTGG - Intronic
1101761179 12:107660247-107660269 CTACAAGCAGGTCAGGGGAGAGG + Intergenic
1101963236 12:109265378-109265400 CCACAAGTAGGCCTGGGGAGGGG - Exonic
1102260139 12:111438395-111438417 CCTCCAGCTGGCCAGGGAAGAGG - Intronic
1102650349 12:114437884-114437906 CCTCATGGAGGGAAGGGAAGAGG - Intergenic
1102718814 12:114998710-114998732 GCACCAGCAGGGCAAGGAAAAGG - Intergenic
1103169757 12:118806637-118806659 CCACAGGCTGGGAAGGGTAGTGG - Intergenic
1103864735 12:124042831-124042853 GGACAAGCAGGGTAGGGGAGAGG - Intronic
1104073249 12:125366017-125366039 CCAGAGGCTGGGAAGGGAAGTGG - Intronic
1104609453 12:130216391-130216413 CCACAGGCAGGGGAGGGGCGGGG + Intergenic
1104876432 12:132038209-132038231 CCAAAAGCAGGGACGGGAAGAGG - Intronic
1104891452 12:132142145-132142167 GCACAACCAGGGCACGGATGTGG + Exonic
1104893398 12:132150816-132150838 CCACATGCAGGGCAGGGGAGTGG - Intronic
1104945886 12:132414761-132414783 TCGCACGCAGGGCAGGGCAGAGG + Intergenic
1104980103 12:132569866-132569888 CCACAGGAGGGGCAGGGACGAGG + Intronic
1105417808 13:20228190-20228212 CCAGAAGCAGGAGAGGAAAGAGG - Intronic
1105476154 13:20729815-20729837 CTGCAAGGAGGGCAGGGCAGGGG - Intronic
1106310259 13:28548006-28548028 CCAGAGGCAGGGAAGGGAAGGGG + Intergenic
1106810741 13:33356450-33356472 CCATAGGCAGTACAGGGAAGTGG + Intergenic
1106842712 13:33702256-33702278 CCAGAAGCGGTGAAGGGAAGAGG - Intergenic
1108593824 13:51933847-51933869 CCACAGGCTGGGCAGGGATATGG + Exonic
1110767614 13:79298929-79298951 ACACAAGAAGGGCAGGGATGAGG - Intergenic
1111139293 13:84093286-84093308 CCAGAACCAGGGAAGGGAAGAGG + Intergenic
1113330704 13:109324284-109324306 CCACAATAAGGGCAGGGAAGAGG + Intergenic
1113728411 13:112622736-112622758 CCACAAGCTGGGCCAGGAGGAGG + Intergenic
1113744916 13:112737520-112737542 CCAGAAGGAGAGGAGGGAAGGGG + Intronic
1113762314 13:112858078-112858100 CCACACACAGGGCAGGGACGGGG - Intronic
1115477041 14:33825662-33825684 GCTGAAGCAGGGCAGGGAAAGGG + Intergenic
1115645826 14:35367959-35367981 CCCCATGCAGGGCTGGGAGGAGG - Intergenic
1115721631 14:36167985-36168007 CCAACAGCAGGGGAGGGAGGGGG - Intergenic
1115918913 14:38349802-38349824 CCAGAAGCTGGGGAGGGTAGTGG + Intergenic
1116898672 14:50341164-50341186 CCACCAGCAGCTCAGGGGAGCGG + Exonic
1117110917 14:52453667-52453689 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
1117814595 14:59583786-59583808 CTACAACCAGGGCAGGGAGTTGG + Intergenic
1117955523 14:61120585-61120607 CCACAAAGAGGGAAGGGAAAAGG + Intergenic
1118703077 14:68453669-68453691 CTAGAAGCAGGGCAGAGAAAGGG - Intronic
1119182533 14:72614463-72614485 CCAGTAGCTGGGAAGGGAAGAGG - Intergenic
1119194598 14:72708230-72708252 CCAGAGGCAGGGCTGGGGAGAGG - Intronic
1119748916 14:77064074-77064096 CCACAAGCAGGGGAGGGGCGGGG + Intergenic
1120017527 14:79490658-79490680 CCAGAGGCTGGGAAGGGAAGTGG + Intronic
1120122677 14:80700955-80700977 CTCAAAGGAGGGCAGGGAAGAGG + Intronic
1120325105 14:83014045-83014067 CCAGAAGAAGGGAAGGGGAGAGG + Intergenic
1121015592 14:90546999-90547021 CCACACACAGGGGAGGGGAGAGG - Intronic
1121312987 14:92945130-92945152 CCCCAGGCAGGGCATGGCAGTGG + Intronic
1121439913 14:93942110-93942132 CCACAAAATGGGCTGGGAAGAGG - Intronic
1122307981 14:100777436-100777458 CAGCAAGCAGGGCCTGGAAGGGG + Intergenic
1122309402 14:100785075-100785097 CCACCAGATGGGCAGGGAATGGG - Intergenic
1122314636 14:100818460-100818482 CCACAAGGAGGGAGGGCAAGGGG + Intergenic
1122622958 14:103070252-103070274 CTCCATGCCGGGCAGGGAAGGGG - Intergenic
1122997154 14:105271472-105271494 CCAGACACAGGGCAGGGAGGGGG + Intronic
1202930764 14_KI270725v1_random:30835-30857 CCAGAAGCAGGACAGGGACAGGG - Intergenic
1123421592 15:20140577-20140599 CCAGAAGCAGGACAGGGACAGGG + Intergenic
1123443462 15:20305938-20305960 CCAGAAGCAGGACAGGGACAGGG - Intergenic
1123530818 15:21147117-21147139 CCAGAAGCAGGACAGGGACAGGG + Intergenic
1123767388 15:23495142-23495164 CCAGAGGCTGGGAAGGGAAGTGG + Intergenic
1124113837 15:26820815-26820837 CCAAAAGCTGGGAAGGGGAGTGG + Intronic
1124649067 15:31461691-31461713 CCACATGCAGGTCAGGAAGGAGG - Intergenic
1125138758 15:36377601-36377623 CCATAAGCTGGGAAGGGTAGTGG - Intergenic
1125606110 15:40940902-40940924 CCACAAGCTGGGCAGGCACTTGG + Intergenic
1127544378 15:59976582-59976604 CCAGAAGCAGAGAACGGAAGAGG - Intergenic
1128538866 15:68511194-68511216 CCACAAGGAGGGCAGTCAGGAGG + Intergenic
1129193843 15:73952852-73952874 CCACAGCCAGGGCAGGGGACGGG - Intergenic
1129205996 15:74037314-74037336 CCCTAACGAGGGCAGGGAAGGGG - Intronic
1129227264 15:74177220-74177242 CCAGGAGCAGGACAGGGAAGAGG - Intergenic
1129386705 15:75200465-75200487 CCACTAGCAGGGCAGGGACAGGG + Intronic
1129545942 15:76395000-76395022 CCACAGGCTGGGAAGGGTAGTGG - Intronic
1129742771 15:77997947-77997969 CCAAAAGCATGGCACGGAAATGG + Exonic
1129937617 15:79463825-79463847 CCACAAGCAGGGCTGGGTTTTGG + Intronic
1131206213 15:90450146-90450168 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
1131377657 15:91938985-91939007 CCACAAGTAGAGCAGGGGACAGG - Intronic
1131805204 15:96114847-96114869 CACCAATCAGGGCAGGGCAGGGG + Intergenic
1132515547 16:364188-364210 GCATAGGGAGGGCAGGGAAGGGG + Intergenic
1132644196 16:991305-991327 CTCCAAGCAGGGCAGGGAGTGGG + Intergenic
1132803322 16:1764564-1764586 CCGGAAGCAGGGCAGCGCAGGGG + Intronic
1132845704 16:1999935-1999957 CCACCAGGAAGGCTGGGAAGGGG - Exonic
1133016377 16:2943645-2943667 CCACAAGCAGGCCAGGCGCGGGG + Intronic
1133061768 16:3179524-3179546 ACCCCAGCAGGTCAGGGAAGCGG - Intergenic
1133581767 16:7151389-7151411 CTTCAAGCAGGGCAGGGTAAAGG + Intronic
1134260083 16:12644126-12644148 CCACAGTCAGGGCAGGGCACCGG - Intergenic
1134635566 16:15789277-15789299 CCAGAAGAAGGGCAGGGGAAGGG + Intronic
1134881666 16:17750092-17750114 CCACAGGCTGGGAAGGGTAGTGG + Intergenic
1135248287 16:20876940-20876962 CCAGAGGCAGGGAAGGGGAGCGG + Intronic
1135906463 16:26516625-26516647 CCACAAACTGGGCACTGAAGTGG - Intergenic
1136070553 16:27784618-27784640 CCACAGGCCTGGCAGGGGAGTGG - Intergenic
1136155573 16:28379988-28380010 CCACAAGCAGGGCACCTACGGGG - Exonic
1136207511 16:28735301-28735323 CCACAAGCAGGGCACCTACGGGG + Exonic
1136271230 16:29149539-29149561 CCAGAGGCTGGGAAGGGAAGTGG - Intergenic
1136536796 16:30904275-30904297 CCACAAGCAAGGCAGAAAAGAGG + Intergenic
1137406410 16:48192884-48192906 CCTGATGCAGGGCAGGGCAGTGG - Intronic
1137556597 16:49474165-49474187 GAACAAGAAGGGCAGAGAAGAGG + Intergenic
1137594407 16:49714275-49714297 CCCCAACCAGGGCAGGGATCTGG + Intronic
1137623887 16:49895441-49895463 GTCCAGGCAGGGCAGGGAAGTGG + Intergenic
1137807280 16:51319349-51319371 GAAGAAGCAGGACAGGGAAGGGG - Intergenic
1137911646 16:52383917-52383939 CTACAAGCAGGGAAGAGAAGGGG - Intergenic
1138550304 16:57744139-57744161 TCAGAAGCACAGCAGGGAAGAGG + Intronic
1139573955 16:67829757-67829779 CCTCTGGCAGGGCAGGTAAGAGG - Exonic
1139967228 16:70752504-70752526 CCATGAGCTGGGCAGGGAACGGG + Intronic
1140545425 16:75803813-75803835 CCAGAGGCTGGGAAGGGAAGAGG - Intergenic
1140709542 16:77663978-77664000 CCACCAGATGGTCAGGGAAGGGG + Intergenic
1140771068 16:78204559-78204581 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
1141813363 16:86391786-86391808 CAACAAGCAAGACAGGGATGGGG - Intergenic
1142005570 16:87688098-87688120 CCCCGAGCAGAGCAGGGAATGGG - Intronic
1142074842 16:88111528-88111550 CCACAGGCTGGGAAGGGAAGTGG - Intronic
1142092455 16:88221814-88221836 CCACAAGCAGAGAAGAGTAGGGG - Intergenic
1142130072 16:88428295-88428317 CCCCATGCAGTGCCGGGAAGGGG - Exonic
1142131099 16:88431832-88431854 CCACCGGCAGGTCTGGGAAGAGG - Exonic
1142742759 17:1940643-1940665 CCACACCCAGGGCTGGGAGGGGG + Intronic
1142875912 17:2852314-2852336 CCACAACCCCGGCAGGGAGGGGG + Intronic
1143104108 17:4519893-4519915 ACACAATCAGGGTAGGGACGGGG - Intronic
1143716743 17:8777302-8777324 CCAGAAGCATGGTAGGGAAGAGG + Intergenic
1144426052 17:15143473-15143495 CTACAAGCAGAGAAAGGAAGTGG + Intergenic
1144427280 17:15155197-15155219 GCAGAAGCTGGGAAGGGAAGTGG + Intergenic
1144451291 17:15381555-15381577 CCTCAAGAAAGGCAGGGCAGGGG - Intergenic
1145892224 17:28425243-28425265 ACACAAGTAGGACAGGAAAGAGG + Intergenic
1146484094 17:33229448-33229470 CTACACGCAGGGCAGAGAGGAGG + Intronic
1146526641 17:33572499-33572521 CCCCAAGCATGGCAAGGAAAGGG + Intronic
1147056107 17:37836394-37836416 AGACAAGCAAGGCAGGAAAGAGG - Intergenic
1147312073 17:39601356-39601378 ACAGAAGCAGGGGAGGGAGGAGG - Intergenic
1147717534 17:42518547-42518569 CCCCCACCAGGGAAGGGAAGCGG + Intronic
1147845192 17:43399783-43399805 CGACATGCAGGGCTTGGAAGTGG - Exonic
1148631502 17:49113423-49113445 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1148749134 17:49934754-49934776 CATCAAGCAGAGCAGGGCAGAGG - Intergenic
1148798852 17:50210669-50210691 CCACAGGCAGGCCTGGGATGAGG + Intergenic
1148850781 17:50554105-50554127 CCACACCCAGAGCGGGGAAGGGG + Intronic
1148901982 17:50885148-50885170 TCAGAAGCAGCGCAGGGAGGTGG - Intergenic
1149231730 17:54542579-54542601 CCACAAGCTAGGAAGGGTAGTGG + Intergenic
1149376254 17:56047232-56047254 AAAGAAGCAGGGCAGGGAGGGGG - Intergenic
1149414907 17:56449008-56449030 CCTGACGCAGGGCAAGGAAGAGG + Intronic
1149992651 17:61391499-61391521 GCACAGGCAGGGCAGGAGAGAGG + Intronic
1150006495 17:61472847-61472869 CCTCAACCAGGGGAGGAAAGGGG - Intronic
1150241547 17:63637917-63637939 GCACAAGCAGGGCAGGGCCTTGG + Intronic
1150639841 17:66942180-66942202 CCGAAAGCAGGAGAGGGAAGAGG - Intergenic
1150883998 17:69064094-69064116 CCATGGGCAGGGCAGGGAAGGGG + Intergenic
1151099585 17:71541614-71541636 CCAGGAGCAGGACAGAGAAGGGG - Intergenic
1151385755 17:73754196-73754218 CCAAAAGCAGGGCTGGCATGTGG - Intergenic
1151425737 17:74029955-74029977 CCAGAGGCCGCGCAGGGAAGGGG + Intergenic
1151537492 17:74747193-74747215 CCTCAGGCAGAGCAGGGAGGAGG + Exonic
1152189760 17:78881284-78881306 CCATAAGCAGGACAGGACAGAGG - Intronic
1152407705 17:80107214-80107236 CCCCAAGCAAGGCTGGGCAGGGG - Intergenic
1152504318 17:80737584-80737606 GCACATGCAGAGAAGGGAAGTGG - Intronic
1152795900 17:82306096-82306118 CCGCATGCAGGGCAGCGCAGAGG - Intergenic
1152804128 17:82347103-82347125 GCACAAGCAGGGCGGGGACCGGG - Intergenic
1153183031 18:2457302-2457324 CCACAGGCTGGGAAGGGTAGAGG - Intergenic
1153809719 18:8741284-8741306 CCACATGGACGGCAGGGAAAAGG - Intronic
1155605639 18:27602462-27602484 CAGCAAGCAGGGCAGGGACAGGG + Intergenic
1156452555 18:37274915-37274937 CCAGAAGCAGGGCCAGGGAGGGG + Intronic
1156525596 18:37764818-37764840 CCAAGAGTAGGGGAGGGAAGTGG + Intergenic
1157128905 18:44984280-44984302 AGACAGGCAGGGCAGGGGAGTGG + Intronic
1158692334 18:59671729-59671751 ATACAAGCAGTGAAGGGAAGGGG + Intronic
1159288916 18:66391114-66391136 TCACAACCAGGGCATGCAAGAGG - Intergenic
1160202384 18:76806559-76806581 CCCCGGGCAGGGCAGGGCAGAGG - Intronic
1160406908 18:78652628-78652650 GGACAGGCAGGCCAGGGAAGAGG + Intergenic
1160498010 18:79386481-79386503 GCTCAAGCAGGGCATGGAATCGG + Intergenic
1160781734 19:880423-880445 CCTCAAGGAGCGCAGGGGAGGGG + Intronic
1160803474 19:980809-980831 CCACAGGCAGGAGAGGGCAGGGG - Intergenic
1161438381 19:4277544-4277566 ACACAGCCAGTGCAGGGAAGGGG + Intergenic
1161499811 19:4607644-4607666 CCTGAAGAAGGGAAGGGAAGAGG + Intergenic
1161510017 19:4665067-4665089 CCACCAGGAGGGCGGGGCAGGGG - Intronic
1161737948 19:6002983-6003005 CAGCAACCTGGGCAGGGAAGAGG + Intronic
1161975699 19:7606833-7606855 CTACAAGCAGGGCAGGCAGACGG - Intronic
1162361592 19:10223807-10223829 CAACAACCAGGCCAGGGCAGAGG - Intronic
1162782599 19:13014310-13014332 CCAGAGGCGGGGGAGGGAAGAGG - Intronic
1162862615 19:13518196-13518218 CCAAAAGCTGGGAAGGGTAGTGG - Intronic
1162932134 19:13962583-13962605 CCTCAGCCAGGGCAGGGAGGGGG - Exonic
1163096408 19:15060753-15060775 CCAGAGGCTGGGAAGGGAAGCGG + Intergenic
1163446732 19:17351500-17351522 CCACAGGCAGGGCTGGGAGTTGG + Exonic
1163545945 19:17941679-17941701 CCACCAGCACAGCAGGAAAGTGG - Intronic
1163699524 19:18780443-18780465 CCACAAGCAGGGCCCTGATGAGG - Exonic
1164618495 19:29680504-29680526 GAACAGGCTGGGCAGGGAAGTGG - Intergenic
1164908840 19:31989326-31989348 TCACAAACAGGGCAGAGGAGGGG - Intergenic
1165468522 19:35989609-35989631 CCACCTGCAGGGGAGGTAAGGGG - Intergenic
1166356582 19:42230734-42230756 CCCCAAGAGGGGCTGGGAAGGGG - Exonic
1167096431 19:47377188-47377210 CCACCTGGAGGGCAGGGATGCGG - Exonic
1167299740 19:48671761-48671783 CCACACCCTGGGCACGGAAGGGG + Intronic
1167699728 19:51035337-51035359 CCCCATGCAGTGCAGGGGAGGGG + Intergenic
926220842 2:10934637-10934659 GCACAAGCAGGGCGGGGTGGAGG - Intergenic
927186722 2:20487404-20487426 CCACTGGCAGTGCAGGGAAAAGG + Intergenic
928037773 2:27841264-27841286 TCACAAGCAGGGTAGGTAACAGG + Intronic
928249668 2:29664477-29664499 CCACAAGAAGACCAGGTAAGGGG - Intronic
928488724 2:31758748-31758770 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
929176169 2:38978727-38978749 ACACAAGCAGTTCAGGGGAGTGG - Intergenic
932125837 2:69144985-69145007 TCACAATCAAGGCAGGAAAGAGG - Intronic
932261217 2:70329296-70329318 CCATGGGCAGGGCAGGGCAGCGG - Intergenic
933782411 2:85811572-85811594 CTAAAAGCAGAGCAGGGAAAAGG - Intergenic
933805448 2:85995693-85995715 CCACAGGGAGGGCAGGAAAGAGG - Intergenic
934238980 2:90251781-90251803 GCACAGGCAGGGCAGGGACAGGG - Intergenic
934504692 2:94880858-94880880 CCAAATGCAGGGCAGGGTGGAGG - Intergenic
934554951 2:95282136-95282158 CCTCAGGCAGTGCAAGGAAGGGG + Exonic
934618122 2:95787829-95787851 CCACCAGCGGGGCAGAGAAAAGG - Intergenic
934642771 2:96036730-96036752 CCACCAGCGGGGCAGAGAAAAGG + Intronic
934891334 2:98072681-98072703 CTGCAGGCAGGCCAGGGAAGAGG + Intergenic
935015473 2:99177853-99177875 CCAGAAGCTGGGAAGGGCAGTGG - Intronic
935201820 2:100863301-100863323 CCACCATCAAAGCAGGGAAGAGG - Intronic
935404788 2:102697660-102697682 TCACAGGTAGAGCAGGGAAGTGG + Intronic
936007998 2:108907083-108907105 CCAGGAGCAGGGCAGGGGTGAGG - Intronic
936057962 2:109275604-109275626 CCCCAGGCAGGGCAGGAAAAGGG - Intronic
936232945 2:110720183-110720205 CCAGGTGCAAGGCAGGGAAGTGG - Intergenic
936258083 2:110934605-110934627 CCACACGGATGGCAGGGAATCGG - Intronic
937278253 2:120700154-120700176 CCAAAAGCAGCACAGGCAAGTGG - Intergenic
937373238 2:121317212-121317234 CCACTGGCAGGGCAGGGAGATGG - Intergenic
937536116 2:122889651-122889673 CCACAAGCAGAGAAGAGAAGAGG + Intergenic
937578437 2:123454088-123454110 CCACAGGCAGGGAACAGAAGTGG - Intergenic
938107536 2:128543608-128543630 CGGGAAGCAGGGGAGGGAAGAGG + Intergenic
938293263 2:130161502-130161524 CCACAACCAGGCCAGGGCTGTGG + Intronic
941063811 2:160878346-160878368 CCACAAGCAGGGCAGGGCAGTGG - Intergenic
942212278 2:173683423-173683445 CCAGAGGCCGGGAAGGGAAGTGG + Intergenic
942323336 2:174754850-174754872 CGACAAGCAGGTTAGGGAAGGGG + Intronic
942383319 2:175416289-175416311 CCAGAAGCTGGGAAGGGCAGTGG - Intergenic
944321943 2:198356190-198356212 CCACAATCAGGTAAGGGATGTGG + Intronic
944361263 2:198860106-198860128 CCAGAAGCTGGGAAGGGCAGTGG + Intergenic
945211237 2:207384873-207384895 CCACAGGCTGGGAAGGGTAGGGG + Intergenic
945304040 2:208241704-208241726 GGACAAGGAGGGCAGGGAAAGGG + Intronic
946688536 2:222294407-222294429 CCGCGAGCAGTGCAGGGCAGCGG - Intronic
947012163 2:225578329-225578351 CACCAAGCAGGGAAGGGAAGAGG + Intronic
947195717 2:227565117-227565139 CCACACCAAGGGCAGGGAAGTGG + Intergenic
947361995 2:229355074-229355096 TCACAAGAAGGGCAGAGAAACGG + Intergenic
948500435 2:238389127-238389149 CCAGCAGCGGGGCAGGGCAGCGG + Intronic
948570893 2:238916584-238916606 CCAGAACCTGGGCAGGGGAGAGG - Intergenic
1168877775 20:1183044-1183066 ACACATGCCAGGCAGGGAAGGGG - Intronic
1169423534 20:5478380-5478402 ACACAAAGAGAGCAGGGAAGGGG - Intergenic
1169427508 20:5508208-5508230 ACCCAAAGAGGGCAGGGAAGGGG + Intergenic
1170000458 20:11608446-11608468 CCAGAATCAGGGCAGGGCTGTGG + Intergenic
1170743260 20:19076365-19076387 CCAGTGGCAGAGCAGGGAAGTGG - Intergenic
1171163930 20:22954339-22954361 CCACAAGCAGGATATGGACGTGG - Intergenic
1171491186 20:25518745-25518767 CCAAAAGCAGGGTGGGGGAGGGG - Intronic
1172428552 20:34872610-34872632 CCCAAGGCAGGGCAGGGACGGGG + Intronic
1172590887 20:36117102-36117124 GCAAGAGCAGGGGAGGGAAGGGG - Intronic
1172945866 20:38688725-38688747 CTGCAAGCCAGGCAGGGAAGGGG + Intergenic
1173038490 20:39436040-39436062 CCAGAGGCTGGGAAGGGAAGTGG - Intergenic
1173249751 20:41358205-41358227 CCAGAACCACAGCAGGGAAGGGG - Intronic
1173849399 20:46208350-46208372 CCAGAGGCAGAGCAGGGATGGGG - Intronic
1173869084 20:46330551-46330573 CCAAAGGCAGGGCAGGGATGGGG - Intergenic
1174038575 20:47683259-47683281 CCTGAAGCAGGGGAGGGACGGGG - Intronic
1174068379 20:47882448-47882470 CCAGAAGCTGGGAAGGGTAGGGG + Intergenic
1174085883 20:48006842-48006864 CCACAGGGAGAGTAGGGAAGAGG + Intergenic
1175180402 20:57142660-57142682 CCAGATGCAGGACAGGGAACAGG + Intergenic
1175838861 20:62014232-62014254 CCACAGGGAGAGAAGGGAAGGGG + Intronic
1176131836 20:63499542-63499564 CCATGAGCAGGGCCGGGGAGGGG - Intergenic
1176166628 20:63677735-63677757 CCACCAACAGGGGAAGGAAGAGG - Intronic
1176166639 20:63677784-63677806 CCACCAACAGGGGAAGGAAGAGG - Intronic
1176166650 20:63677833-63677855 CCACCAACAGGGGAAGGAAGAGG - Intronic
1176166661 20:63677882-63677904 CCACCAACAGGGGAAGGAAGAGG - Intronic
1176166672 20:63677931-63677953 CCACCAACAGGGGAAGGAAGAGG - Intronic
1176195870 20:63836148-63836170 GCGCAGGCAGGGCAGGGGAGAGG + Intergenic
1176195939 20:63836338-63836360 GCGCAGGCAGGGCAGGGGAGAGG + Intergenic
1176236562 20:64056362-64056384 CCACCAGCAGGGCAGCGACGGGG - Intronic
1176244972 20:64093131-64093153 CCACAGGGAGGGGAGGGGAGGGG + Intronic
1176267450 20:64217676-64217698 CCAGAGGCAGGGCTGGGAAATGG - Intronic
1176899864 21:14427144-14427166 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1178037705 21:28603178-28603200 GAAGAAGCAGGGCAGGGATGGGG - Intergenic
1178437033 21:32569228-32569250 GCACAAGCAGAGGAGGAAAGGGG + Intergenic
1178797520 21:35758629-35758651 CCAGAGGCTGGGAAGGGAAGAGG + Intronic
1179061095 21:37980220-37980242 TGACCAGCAGGGCAGGAAAGTGG + Intronic
1179597169 21:42450673-42450695 CCTCAAGCTGGGCAGCCAAGGGG + Intergenic
1179628121 21:42659994-42660016 GCATAAGCCGGGCAGGGAGGCGG + Intronic
1179779710 21:43691577-43691599 CCACAAGGCGGTCGGGGAAGAGG + Intronic
1180234276 21:46447946-46447968 CCTCCAGCAGGTCAGGGAGGCGG - Intergenic
1180600338 22:17011252-17011274 AAACAAGGTGGGCAGGGAAGGGG - Intergenic
1180950318 22:19717958-19717980 CCCCAAGCAGGGCTGGGGAGGGG + Intronic
1180952880 22:19728664-19728686 CCAGAATCCGGGCAGGGCAGTGG - Intergenic
1180953027 22:19729292-19729314 GTCCAAGCAGGGCAGGGGAGGGG + Intergenic
1181048861 22:20229300-20229322 CCACAAGCTGGGCCGAGGAGAGG - Intergenic
1181205533 22:21249195-21249217 TCACAAGCAAGCCAGTGAAGAGG + Intergenic
1181289040 22:21776640-21776662 CCACAGGCAGGTCAAGGCAGTGG - Intronic
1181405867 22:22684972-22684994 ACACATGCAGTGCAGGGATGTGG - Intergenic
1181747742 22:24967583-24967605 CCTCAAGGAGGACAGAGAAGAGG + Intronic
1182424820 22:30266429-30266451 TCAGAAGCTGGGCAGGGAAGTGG - Intronic
1183049266 22:35247506-35247528 TCACACGCAGAGCATGGAAGAGG - Intergenic
1183153086 22:36053512-36053534 GGAGAAGCAGGGAAGGGAAGGGG - Intergenic
1183321825 22:37169669-37169691 CCACATGCAGGGCAGGGAGGGGG - Intronic
1183395694 22:37569512-37569534 CCCCCAGCAGGGAAGGGAAGTGG + Intergenic
1183472445 22:38016846-38016868 ATACAAGCTGGGGAGGGAAGAGG + Intronic
1183802847 22:40182422-40182444 TCACAAGCAGGTGAGGAAAGTGG - Intronic
1184549505 22:45196971-45196993 GCGCCAGCAGGGGAGGGAAGAGG + Exonic
1184941602 22:47770372-47770394 CCAAAAAGATGGCAGGGAAGGGG + Intergenic
1185055807 22:48577721-48577743 CCAAAAGCAAGGGAGGGAAGTGG - Intronic
1185147507 22:49147285-49147307 CCAGAAGCAGGGGAAGGGAGAGG - Intergenic
1185164787 22:49254901-49254923 CCACAACCTGGGGAGGGACGAGG + Intergenic
1185220502 22:49627121-49627143 CCACCAGGAGGGCAGGGGTGGGG + Intronic
949500117 3:4671651-4671673 CCACCTGAAGGGAAGGGAAGGGG + Intronic
950052747 3:10004658-10004680 GCACAGACAGGGCAGAGAAGAGG - Intronic
950176174 3:10876467-10876489 CCATAAGCAGAGGAGAGAAGGGG - Intronic
950228385 3:11254845-11254867 CACCAAGCAGGGTAGGGCAGGGG + Intronic
950330618 3:12153359-12153381 CCACTGTCAAGGCAGGGAAGGGG - Exonic
950682907 3:14597340-14597362 CCATTAGGATGGCAGGGAAGAGG + Intergenic
950840165 3:15960669-15960691 CCACAAGCTGGAGAGGCAAGTGG - Intergenic
950941963 3:16901873-16901895 TCACAAGCGGGGCAGGGTGGAGG - Intronic
950958144 3:17077119-17077141 CCAGATGCAGTGCAGGAAAGGGG - Intronic
952900660 3:38109737-38109759 CCACACAGAGGGCAGGGATGGGG - Intronic
953629967 3:44605838-44605860 CCAGAAGCTGGGGAGGGTAGTGG + Intronic
954124150 3:48518864-48518886 CCACAGCCAGGGAAGGGGAGAGG + Exonic
954371522 3:50171650-50171672 CCACCCCCAGGGCTGGGAAGTGG - Intronic
954706429 3:52483212-52483234 CCACAAGCGAGGCAGGCAGGTGG - Intronic
954993654 3:54862564-54862586 CGACAAGCAGGGCAGGAAGCTGG - Intronic
955141498 3:56274301-56274323 CCACAAACAGGGCTGGGCAGGGG - Intronic
955403266 3:58608814-58608836 CCATAAGCAGGGCAGAGGAGCGG + Intronic
955773395 3:62408427-62408449 CCAAGAGCAGGGCTAGGAAGAGG - Intronic
955956338 3:64293652-64293674 CCATAGGCAGGACAGGGAAATGG - Intronic
956342548 3:68242191-68242213 CCACAAGCAGGGCAGGAGAAGGG - Intronic
956639219 3:71399592-71399614 TGACAACCAGGGCAGGGAAAGGG + Intronic
956723650 3:72139234-72139256 CCACAAACCCTGCAGGGAAGTGG + Intergenic
956786439 3:72646622-72646644 CCAGAGGCTGGGCAGGGTAGGGG + Intergenic
957112471 3:75981920-75981942 CCAGAAGCTGGGAAGGGTAGGGG - Intronic
957889718 3:86340726-86340748 CCACAGGCTGGGAAGGGTAGTGG - Intergenic
959132680 3:102377176-102377198 TCACAGGAAGGGCAGGGAAAGGG + Intronic
959496314 3:107056899-107056921 CTTCAAACTGGGCAGGGAAGGGG - Intergenic
959732423 3:109619156-109619178 ACAAAAGGAGGGAAGGGAAGGGG - Intergenic
960156063 3:114298150-114298172 CTACATGCAGGGTGGGGAAGGGG - Intronic
961156325 3:124682840-124682862 TCACAAGCAGGGGAAGGAAAAGG - Intronic
962349906 3:134649096-134649118 TCACAACCAGAGCAGAGAAGAGG - Intronic
962810982 3:138959503-138959525 CCAGAAGCAGGGCTCTGAAGGGG + Intergenic
962857016 3:139356112-139356134 CCACCAACAGGACAGGGTAGAGG + Intronic
963135536 3:141900239-141900261 CTCCAAGGAGGGCAGGAAAGAGG + Intronic
963458852 3:145579812-145579834 CCATGAGCAGGGCAGGAGAGGGG - Intergenic
963796383 3:149634822-149634844 TGAGAATCAGGGCAGGGAAGAGG - Intronic
963846146 3:150159842-150159864 CCCCAGGGAAGGCAGGGAAGGGG + Intergenic
964853253 3:161117956-161117978 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
966222775 3:177566988-177567010 CCATAGACAGGGCAGGGGAGGGG - Intergenic
966231627 3:177658790-177658812 CTACCAGCATTGCAGGGAAGAGG - Intergenic
966911538 3:184562642-184562664 CCACACTCACGGCAGAGAAGTGG + Intronic
967397750 3:189025361-189025383 AGAAAAGCAGGGCAGGGCAGTGG - Intronic
967638160 3:191830060-191830082 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
967979024 3:195054408-195054430 CCAAGAGCTGGACAGGGAAGGGG + Intergenic
968294765 3:197567475-197567497 GCAAAAGCAGGACAGGGAGGGGG - Intronic
968863073 4:3188130-3188152 CCTCAGGCAGGGCAGGGCAGTGG + Intronic
968952276 4:3701364-3701386 CCACAGCCAGTGCAGGGCAGTGG - Intergenic
969431137 4:7154973-7154995 TCAGAATCAGGGCAGGAAAGTGG + Intergenic
969438014 4:7199656-7199678 CCCCACCCAGGCCAGGGAAGCGG - Intronic
970616712 4:17774455-17774477 CCAGAGGCAGGGCAGGGCTGGGG + Intronic
971047036 4:22816356-22816378 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
971244473 4:24915645-24915667 CCACATGCTGGGGAGGGTAGAGG - Intronic
971312346 4:25536263-25536285 CCATAGGGAGGTCAGGGAAGAGG - Intergenic
971942697 4:33236292-33236314 CCAAAAGCAGGGAAGGTATGAGG - Intergenic
972264920 4:37451010-37451032 AAACAGGCAGGGCAAGGAAGAGG + Intergenic
972451237 4:39200740-39200762 CAAAAAGTAGGGCAGGGATGGGG + Intronic
973026837 4:45283814-45283836 CAACATGGAGAGCAGGGAAGAGG + Intergenic
973567514 4:52203097-52203119 CTTCAAGCAGGGAAGGGAGGTGG - Intergenic
975568996 4:75792830-75792852 TCAGAGGCAGGGCAGGGTAGTGG - Intronic
976428438 4:84933676-84933698 CCAGAAGCTGGGCAGGGTAGTGG - Intronic
976812238 4:89110234-89110256 CCAAATGGAAGGCAGGGAAGAGG + Intronic
977122220 4:93116602-93116624 CCAGAAACAGAGCAGGAAAGGGG - Intronic
977736149 4:100418541-100418563 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
978217853 4:106228392-106228414 CCACAGGCTGGGAAGGGTAGTGG - Intronic
978293376 4:107173510-107173532 TAACAAGCAGAGCAGGAAAGAGG + Intronic
978611679 4:110547503-110547525 CAAAAAACAGGACAGGGAAGTGG + Intronic
980630949 4:135432465-135432487 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
980719160 4:136670771-136670793 TCACCAGCAAGGGAGGGAAGAGG + Intergenic
980885561 4:138758750-138758772 CCAGAATCAGGGCAGGGCAAAGG + Intergenic
982176813 4:152713442-152713464 CCAGAGGCTGGGAAGGGAAGAGG + Intronic
982340345 4:154291788-154291810 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
984429359 4:179628131-179628153 CTTCCAGCAGTGCAGGGAAGTGG - Intergenic
984576986 4:181462325-181462347 TGACATGCAGGGCAGGGAAATGG - Intergenic
984881362 4:184412585-184412607 TCACAAGCAGGTCAGGGAACTGG + Intronic
985333636 4:188868692-188868714 CCACATGCAGAGCAAGGAAGAGG - Intergenic
985682006 5:1260694-1260716 CCCCAGGCAGGACAAGGAAGCGG - Intronic
985729879 5:1541162-1541184 CCTCAGGAAGGGCAGGGATGAGG - Intergenic
985911480 5:2887406-2887428 CCACCAGGAGGGACGGGAAGCGG - Intergenic
986262623 5:6161601-6161623 CCATAACCAGGCCAGGGATGGGG + Intergenic
986510731 5:8503841-8503863 CCAACAGCAGTGGAGGGAAGAGG + Intergenic
986614144 5:9599597-9599619 CCACCTGCAGGGGAGAGAAGCGG + Intergenic
986729731 5:10626236-10626258 CCGAAAGCAGGGCAAGGAAGAGG + Intronic
987021577 5:13878122-13878144 CCAGGAGCAGTGCAGAGAAGGGG + Intronic
989309756 5:40000967-40000989 TCACAAGGAGGGCAGGCAAGAGG + Intergenic
991352514 5:65733590-65733612 CCACAGGAAGGGCAGGGGACGGG - Intronic
991639008 5:68734885-68734907 TCACAGGCTGGGCCGGGAAGTGG - Intergenic
992013828 5:72556783-72556805 AGACAAGCAGGGCAGGGGTGAGG + Intergenic
992570035 5:78046100-78046122 CAACAACAAGGGAAGGGAAGTGG - Intronic
992828283 5:80570301-80570323 CCGCAAGCAGGGCGGGGACTGGG - Exonic
993902663 5:93595287-93595309 CCACAAGCGGGGCGGGGCAGGGG - Intergenic
996107622 5:119522937-119522959 GCAAAAGCAGTGCATGGAAGAGG - Intronic
996257220 5:121419027-121419049 TCAGAAGCAGGGAAGGGTAGTGG - Intergenic
996403933 5:123089032-123089054 CCAGAAGAAGGGGAGGGGAGAGG - Intergenic
996760672 5:126983280-126983302 GCTCCAGGAGGGCAGGGAAGGGG + Intronic
997362313 5:133302969-133302991 AGACCAGCAGAGCAGGGAAGAGG - Intronic
997455244 5:134011996-134012018 ACAGAAGCAGAGCAGGGCAGGGG + Intergenic
997638467 5:135432868-135432890 TCACAAGCAAGGGAGGAAAGAGG + Intergenic
998134082 5:139665583-139665605 GCCCAAGCTGGGCAGGCAAGAGG - Intronic
998721367 5:144954540-144954562 ATCCAAGTAGGGCAGGGAAGGGG - Intergenic
998929977 5:147170775-147170797 CCACAGGCCAGGCAGGGGAGCGG + Intergenic
999238837 5:150115732-150115754 CTTCAGGCAGGGCAGGGTAGGGG + Exonic
999243559 5:150140971-150140993 ACACAGGCAGGCCAGGGAGGGGG + Intronic
999487271 5:152009645-152009667 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
1000178549 5:158783877-158783899 CCAGAAGAGAGGCAGGGAAGAGG + Intronic
1000285188 5:159820464-159820486 CCACAATCAGGGCTGGGAGTAGG + Intergenic
1001749446 5:174117727-174117749 CCAGAAGCTGGGCAGGGCGGGGG + Intronic
1002412344 5:179091949-179091971 CCAGATGCTGGGAAGGGAAGTGG - Intergenic
1002783122 6:382147-382169 CCACAAGCTCGGCAGGAAGGAGG + Intergenic
1003068005 6:2919639-2919661 CCACAAGGGCAGCAGGGAAGAGG + Intergenic
1003389809 6:5703891-5703913 GCACAAGCCGGGAAGGCAAGAGG - Intronic
1004106049 6:12668337-12668359 CCCCAAGAAAGGCAGAGAAGGGG - Intergenic
1006285885 6:33093616-33093638 CATAAAGCAAGGCAGGGAAGTGG + Intergenic
1006300642 6:33192151-33192173 CCCCAGGCTGGGCAGGTAAGAGG - Exonic
1006513440 6:34533598-34533620 CCCCAGGCAGGCCAGAGAAGAGG - Exonic
1006946396 6:37787216-37787238 TCAGAAGAAAGGCAGGGAAGTGG + Intergenic
1007385304 6:41516501-41516523 CCTGAAGTAGGGCAGGGAAGGGG - Intergenic
1007630044 6:43268418-43268440 CCTCCAGCAGAGTAGGGAAGAGG - Intronic
1008098468 6:47365383-47365405 CCAAAAGCATGACAGGGAAATGG + Intergenic
1009391413 6:63148222-63148244 CCAGAAGCTGGGAAGGGTAGGGG + Intergenic
1009658554 6:66578608-66578630 CCAAGGGCAGGGCAGGGAAATGG - Intergenic
1009811215 6:68669392-68669414 CCAGAGGCAGGGAAGGGTAGTGG - Intronic
1010229188 6:73520403-73520425 CCTGCAGCAGGGCCGGGAAGCGG + Exonic
1010678320 6:78769770-78769792 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1011446647 6:87448653-87448675 CCAGAGGCTGGGAAGGGAAGTGG - Intronic
1011614558 6:89186042-89186064 CCAGAAGCAGGTGAGGGAAGGGG - Intronic
1013308526 6:108872168-108872190 CCACAGGCAGGGCCGGGGTGTGG + Intronic
1013775001 6:113669739-113669761 ACAACAGCAGAGCAGGGAAGTGG - Intergenic
1014227536 6:118864846-118864868 CCAAGAGCAGTGCAGAGAAGGGG + Intronic
1014639997 6:123897802-123897824 CCAGAGGCAGTGAAGGGAAGAGG - Intronic
1014963493 6:127716603-127716625 CCAGAAGCAGGTCTGGGCAGAGG - Intronic
1015135267 6:129862216-129862238 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
1015174853 6:130295831-130295853 GGTCAAGAAGGGCAGGGAAGTGG - Intronic
1015181464 6:130366109-130366131 CAGCAAGCCGGGCAGGGGAGAGG - Intronic
1015517817 6:134101831-134101853 CCAGAAGCTGGGAAGGAAAGAGG + Intergenic
1015959973 6:138638200-138638222 CCAGAAGCTGGGAAGGGCAGTGG + Intronic
1016405209 6:143722757-143722779 CCAGAAGCTGGGAAGGGTAGTGG - Intronic
1017042956 6:150322518-150322540 CCTCAGGGAGGGCAGAGAAGTGG + Intergenic
1017663419 6:156695775-156695797 AGAGAAGCAGGGCTGGGAAGAGG - Intergenic
1018090951 6:160347189-160347211 CGAAAGGCAGGGCAGGAAAGGGG + Intergenic
1018180956 6:161223064-161223086 ACACAGGGAGTGCAGGGAAGGGG - Intronic
1018506625 6:164477045-164477067 AAACATGCAGGGCAGGGCAGGGG + Intergenic
1018973475 6:168545616-168545638 CCAGAATCAGGGCTGGGAGGAGG + Intronic
1019101177 6:169631509-169631531 CCACAGGGAGGGCACGGAGGTGG + Intronic
1019164805 6:170091139-170091161 CCAGGAGCAGGGCAGGGAGCAGG - Intergenic
1019272212 7:156655-156677 CCAGGACCAGGGCAGGGCAGAGG - Intergenic
1019355099 7:574293-574315 CCGAGAGCAGGGCAGGGCAGGGG + Intronic
1019522959 7:1468827-1468849 GCAGATGCAGGGCAGGGATGTGG - Intergenic
1019526707 7:1483645-1483667 CCAGAAGCAAGGCAAGGATGCGG + Intronic
1019774982 7:2906939-2906961 GGAGAAGCAAGGCAGGGAAGGGG - Intronic
1021035453 7:15792830-15792852 CCAGAGGCTGGGCAGGGTAGTGG + Intergenic
1022171763 7:27838371-27838393 CCTCATGCAGAGCAGGGAATGGG - Intronic
1022504114 7:30899985-30900007 CCCCAAGCAGGGCAGAGGAGAGG + Intergenic
1022598438 7:31734404-31734426 CCAACAGCAGTGCAGAGAAGTGG - Intergenic
1023959430 7:44914116-44914138 GCACAACCAGGGGTGGGAAGAGG - Intergenic
1024043928 7:45574843-45574865 CCACGAGCAGCGCCAGGAAGAGG - Exonic
1024350687 7:48359636-48359658 GCAGAAGCAGGGAAGGGCAGAGG + Intronic
1026277059 7:68889215-68889237 CCATCAGCAGGGCAGGAAACAGG + Intergenic
1026283816 7:68945592-68945614 CCACAGGCAAAGCAGGGCAGAGG + Intergenic
1026741975 7:72984552-72984574 GCAAACGCAGGGCAGGCAAGGGG + Intergenic
1026828923 7:73600024-73600046 CCTCCAGCAGATCAGGGAAGGGG - Intronic
1027101760 7:75380525-75380547 GCAAACGCAGGGCAGGCAAGGGG - Intergenic
1027427341 7:78074863-78074885 CCAGAAGCAAGCCAGAGAAGTGG - Intronic
1027494757 7:78873694-78873716 CCACAGACAGGGCAAGGGAGTGG - Intronic
1027991632 7:85370258-85370280 CTTCAAGCAGGGAAAGGAAGAGG + Intergenic
1029236142 7:99120777-99120799 CCACATGCAGAGCAGTGTAGTGG + Intronic
1029409908 7:100402462-100402484 CCACAGTTAAGGCAGGGAAGTGG - Intronic
1029506628 7:100967017-100967039 CCCCCACCAGGGCAGGGAGGGGG + Intronic
1030017777 7:105242189-105242211 TCACAAGCAGGCAAAGGAAGAGG - Intronic
1030103048 7:105962884-105962906 CCAGAAACAGGGGTGGGAAGTGG - Intronic
1030299396 7:107960169-107960191 CCATAAGCAGGGTAGGGAGAGGG - Intronic
1030924428 7:115434304-115434326 CCAGAAGCTGGGAAGAGAAGTGG - Intergenic
1032080021 7:128854137-128854159 CCCCAAACACAGCAGGGAAGGGG - Exonic
1032350606 7:131159553-131159575 CCAGAGGCTGGGAAGGGAAGGGG + Intronic
1034343327 7:150371491-150371513 CCACACTCAGGGCAGGGCAAGGG - Exonic
1034539117 7:151744809-151744831 CCACCAGCAGAGCAGGGCAGGGG + Intronic
1035432282 7:158830898-158830920 CCCCAAGCAAGGAATGGAAGTGG + Intergenic
1035661020 8:1348854-1348876 GCACAAGCAGGACATGGATGGGG - Intergenic
1035667610 8:1390586-1390608 CCTCAAGCAGGCAAGGGAGGCGG - Intergenic
1035688061 8:1540039-1540061 CCACAGGGAGAGCAGGCAAGAGG - Intronic
1036548915 8:9799730-9799752 CCACAAGGAGGCCAGGGCAGGGG + Intergenic
1036611159 8:10350918-10350940 CCACAGGCAGGGCAGGCAGTAGG - Intronic
1036776734 8:11617900-11617922 CCACAGGCAGGGCGGGGGAGGGG + Intergenic
1037522461 8:19693212-19693234 CCACAAGCAGAGAAAGGCAGGGG - Intronic
1037568885 8:20141712-20141734 CAACAAGGAGGGCAAGGAGGAGG + Intergenic
1037840845 8:22244624-22244646 CCACCAGGAGCACAGGGAAGGGG + Intergenic
1038396576 8:27250081-27250103 CCACAAGCAGTACAGGAAGGTGG + Intronic
1038452961 8:27651578-27651600 CCAGGAGCAGGGCCAGGAAGAGG - Exonic
1038798742 8:30731004-30731026 CCACAAAAAGGCAAGGGAAGGGG + Intergenic
1038828610 8:31033324-31033346 CCGCCAGGAGGGGAGGGAAGGGG + Exonic
1039466646 8:37789357-37789379 CCAAACTCTGGGCAGGGAAGAGG - Intronic
1039675040 8:39653972-39653994 CCAGAGGCTGGGAAGGGAAGTGG - Intronic
1040533361 8:48283702-48283724 CTTCCAGCAGGGCAAGGAAGAGG - Intergenic
1041487461 8:58394847-58394869 CCAGAGGCAGGGCAGTGAATAGG - Intergenic
1041647413 8:60267566-60267588 CCACAGACAGGGCAGAAAAGCGG + Intronic
1041654006 8:60330553-60330575 CCAGCAGCAGGGCAGGGGTGGGG + Intergenic
1044192517 8:89335724-89335746 CCAGAGGCTGGGAAGGGAAGTGG - Intergenic
1044952754 8:97449803-97449825 CCTCAAGCAGGGCAGGCAAAGGG - Intergenic
1046115550 8:109779418-109779440 CCAGAAGCAGTACAGGAAAGTGG + Intergenic
1047613970 8:126547613-126547635 TGACAGGAAGGGCAGGGAAGGGG + Intergenic
1047991209 8:130288590-130288612 CCCTAAGCAGGGCAGTGTAGAGG + Intronic
1048558354 8:135505358-135505380 CCACAAGCAGGGCAGGGAAGTGG - Intronic
1048948374 8:139472004-139472026 ACACAGGCAGGACAGGGGAGAGG - Intergenic
1049021099 8:139958162-139958184 CCAGAAGGAGGGAAGGAAAGTGG + Intronic
1049164805 8:141119208-141119230 CCAGCTGTAGGGCAGGGAAGTGG - Intronic
1049184756 8:141244211-141244233 CTGCAGGCAGGGCAGGGAAGAGG - Intronic
1049312290 8:141939483-141939505 CCACAGGCAGGGCAGGGGCACGG + Intergenic
1049368302 8:142251472-142251494 CCACGAGCAGCTCAGGGCAGAGG + Intronic
1049396629 8:142403848-142403870 CCGCAGGCAGAGCAGGGAAAGGG - Intergenic
1049450731 8:142660098-142660120 ACAAGAGCTGGGCAGGGAAGAGG + Intronic
1049555065 8:143277590-143277612 GCACAGGCAGGGCAGGGAGAAGG - Intergenic
1049748806 8:144274027-144274049 ACCCAGGAAGGGCAGGGAAGTGG + Intronic
1050510798 9:6393234-6393256 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1053348383 9:37395019-37395041 CCAAAAGCAGCAAAGGGAAGAGG + Intergenic
1056221414 9:84453715-84453737 CCACACGTGGGGCAGAGAAGAGG - Intergenic
1056332340 9:85531484-85531506 CCAGAGGCAGGGAAGGGCAGGGG - Intergenic
1056978300 9:91282106-91282128 CCACAACCAGAGCAGAGAGGAGG - Intronic
1057192288 9:93094849-93094871 ACACAGGCAGGGAAGGAAAGAGG + Intergenic
1057519302 9:95748540-95748562 AGACCAGCAGAGCAGGGAAGTGG - Intergenic
1058340894 9:103894891-103894913 CCAGAAGCTGGGAAGGGTAGAGG + Intergenic
1058592261 9:106577446-106577468 CAAAAAGCAGTGAAGGGAAGTGG + Intergenic
1058893502 9:109381146-109381168 CTGCAAGCGGGGCAGTGAAGCGG - Intronic
1059279952 9:113124471-113124493 CCACTAGCAGGGCACATAAGGGG - Intergenic
1060074636 9:120580214-120580236 CCAGAGGACGGGCAGGGAAGCGG + Intergenic
1060176273 9:121499591-121499613 CCACGAGCAGGACACGGACGGGG - Intergenic
1060767346 9:126304740-126304762 CCAGAAGCAGTCCAGGGGAGGGG + Intergenic
1060933112 9:127501162-127501184 CCACAGGCAGGGCAGGCGGGTGG - Intronic
1061079195 9:128360215-128360237 GGACAAACAGGGGAGGGAAGTGG - Intronic
1061275182 9:129566007-129566029 CCACCAGCAGCTCAGAGAAGTGG + Intergenic
1061372207 9:130203677-130203699 CCTCTTCCAGGGCAGGGAAGAGG + Intronic
1061861535 9:133470968-133470990 GCAAAAGCAGGGCAGGGAAAAGG - Intergenic
1061972897 9:134054331-134054353 CCACAGGCAGGGCTGGCAGGAGG + Intronic
1062017988 9:134301364-134301386 CCACATGGAGGTCAGGGAGGAGG - Intergenic
1062117378 9:134816723-134816745 CCACAACCTGGGCAGGGACGAGG - Intronic
1062205993 9:135337717-135337739 CCCCAAGCACGGCAGGGATGAGG + Intergenic
1062224552 9:135442180-135442202 CCCCAAAGAGGCCAGGGAAGGGG - Intergenic
1203622830 Un_KI270749v1:138264-138286 CCAGAAGCAGGACAGGGACAGGG - Intergenic
1185670340 X:1804531-1804553 CCACAAGAAGAGATGGGAAGGGG - Intergenic
1186103437 X:6180922-6180944 AAAAAAGCAGGGCAGGGCAGTGG - Intronic
1187102112 X:16204222-16204244 CCAGAAGCTGGGCAGGGTAATGG + Intergenic
1187178769 X:16922321-16922343 CCAGAGGCTGGGAAGGGAAGAGG + Intergenic
1187267322 X:17747189-17747211 TCAGAAGAAGGGCAGGGATGAGG - Intronic
1189247695 X:39576303-39576325 GCACAGGCATGGCAGGGGAGGGG - Intergenic
1189545667 X:42040264-42040286 CCAACATCAGGGTAGGGAAGGGG - Intergenic
1189587951 X:42480121-42480143 CCACAAGCTGAGAAGGGTAGTGG + Intergenic
1189850430 X:45171619-45171641 CCACAGGCAGGGCAAAGACGTGG - Intronic
1190868113 X:54401612-54401634 CCAGAAGCTGGGAAGGGAGGGGG - Intergenic
1191892501 X:65958680-65958702 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1191974237 X:66852280-66852302 CCACAGCCAGAGCAGGGCAGAGG + Intergenic
1192048646 X:67702674-67702696 CAACAACTAGGGTAGGGAAGAGG - Intronic
1192633475 X:72794890-72794912 CCAGAAGCTGGGGAGGGAAGGGG - Intronic
1192639038 X:72845987-72846009 TCACATGCTGGGCAGGGCAGGGG - Exonic
1192642674 X:72874821-72874843 TCACATGCTGGGCAGGGCAGGGG + Exonic
1192648234 X:72925911-72925933 CCAGAAGCTGGGGAGGGAAGGGG + Intronic
1192809194 X:74534874-74534896 CCACATACTGGGCAGGGCAGGGG + Intergenic
1193098974 X:77585979-77586001 CCACAGGCTGGGAAGGGTAGTGG + Intronic
1193348251 X:80429177-80429199 CCACAAGCTGGACAGGGTTGAGG + Intronic
1193581532 X:83269745-83269767 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1193665905 X:84316328-84316350 CCAGAAGCTGGGAAGGGTAGTGG + Intergenic
1194312504 X:92329819-92329841 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
1194401308 X:93440352-93440374 CCACAAGCAGGCCAGGGGACTGG + Intergenic
1195077358 X:101339779-101339801 CCTCTAGCAGGGCTGGGAATAGG - Intergenic
1196264240 X:113623183-113623205 CCAGAAGCTGGGAAGGGTAGTGG - Intergenic
1196352267 X:114745795-114745817 CCAGAAGCTGGGAAGGGTAGTGG + Intronic
1196510289 X:116501407-116501429 CAAAAAGCAGGGAAGGGATGTGG - Intergenic
1197362696 X:125526223-125526245 CCAAAAGCTGGGAAGGGTAGTGG - Intergenic
1197642334 X:128980782-128980804 CCAGAGGCTGGGAAGGGAAGTGG + Intergenic
1197761359 X:130030643-130030665 CCACAAGCAGCGCTGGGAAAAGG + Intronic
1198045324 X:132896108-132896130 CCAGAGGCTGGGAAGGGAAGTGG + Intronic
1198082478 X:133252533-133252555 CCAGAAGCAGAGGAGGGCAGAGG + Intergenic
1198114905 X:133535602-133535624 CCAGAAGGAAGGCAGGGAGGTGG + Intergenic
1198960456 X:142176792-142176814 CAGCAAGCAGGGCAGGGCGGTGG - Intergenic
1199361071 X:146919585-146919607 CCAGAGGCTGGGCAGGGTAGTGG - Intergenic
1199864081 X:151827511-151827533 CCACAGGCAGAGAAGGGGAGAGG - Intergenic
1199891445 X:152086938-152086960 GGACAAGCAGGGGAGGGATGAGG - Intergenic
1200099677 X:153684448-153684470 CCTGCAGCAGGGCAGGGATGGGG - Intronic
1200976883 Y:9220792-9220814 CTACAAGCTGAGCAGTGAAGAGG - Intergenic
1201544096 Y:15141573-15141595 CTAGAAGCAGGGAAGGGTAGGGG + Intergenic