ID: 1048558356

View in Genome Browser
Species Human (GRCh38)
Location 8:135505364-135505386
Sequence AAGGGACCACAAGCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558356_1048558364 3 Left 1048558356 8:135505364-135505386 CCCTGCCCTGCTTGTGGTCCCTT 0: 1
1: 1
2: 3
3: 22
4: 295
Right 1048558364 8:135505390-135505412 ACCCTTGAGAGCTCTCCTTCAGG No data
1048558356_1048558369 20 Left 1048558356 8:135505364-135505386 CCCTGCCCTGCTTGTGGTCCCTT 0: 1
1: 1
2: 3
3: 22
4: 295
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558356_1048558366 4 Left 1048558356 8:135505364-135505386 CCCTGCCCTGCTTGTGGTCCCTT 0: 1
1: 1
2: 3
3: 22
4: 295
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558356 Original CRISPR AAGGGACCACAAGCAGGGCA GGG (reversed) Intronic
900343830 1:2201427-2201449 AAGGGACCTGAGGCTGGGCACGG + Intronic
901252920 1:7795481-7795503 CAGCGACCAGAAGGAGGGCAGGG + Intronic
901823531 1:11845976-11845998 CAGGGAGGACAAGCAGGGCTGGG - Exonic
901961179 1:12827911-12827933 GAGGGACAACAAGCAGGGAGGGG - Intronic
902017401 1:13319269-13319291 GAGGGACAACAAGCAGGGAGGGG + Intronic
902730895 1:18368208-18368230 AAGATATCACAAGCAGGGCCAGG + Intronic
902989452 1:20176212-20176234 AAGGGAACACATGCTGGGCCGGG - Intronic
903250299 1:22048389-22048411 ATGGGCAGACAAGCAGGGCAGGG + Intergenic
903830180 1:26169938-26169960 AAGGGGCCAGGAGCAGGGCAGGG - Exonic
904326469 1:29729788-29729810 ACGTGAGCACCAGCAGGGCAGGG - Intergenic
905248081 1:36628568-36628590 CAGGGACCACAAGCAGGTTGTGG - Intergenic
906309085 1:44740182-44740204 AAGGGACCACGTACAGCGCAGGG - Intronic
907325582 1:53636849-53636871 AAGGGGCCACACTCAGTGCAGGG + Intronic
907585694 1:55615923-55615945 AAGGGAGAAAAAGCAGAGCAGGG + Intergenic
908510585 1:64847431-64847453 ACTGGGCCACAAGAAGGGCAAGG + Intronic
911178662 1:94842385-94842407 AAGGGGCTACAAGGTGGGCATGG + Intronic
911860612 1:102943208-102943230 AAATCACCTCAAGCAGGGCATGG - Intronic
912546861 1:110457253-110457275 AAGGGACAGGGAGCAGGGCAGGG + Exonic
913404649 1:118476175-118476197 AAGGGAATAAAAGCAGGCCACGG + Intergenic
913516500 1:119609823-119609845 AAGAGACCACAAGCCGGGCGCGG - Intergenic
913977805 1:143478134-143478156 AAGGGATCTCAAGGAGAGCAGGG - Intergenic
914072209 1:144303763-144303785 AAGGGATCTCAAGGAGAGCAGGG - Intergenic
914106946 1:144662593-144662615 AAGGGATCTCAAGGAGAGCAGGG + Intergenic
914835756 1:151205514-151205536 AAGGGAACAAGAGCCGGGCATGG + Intronic
914976084 1:152363957-152363979 GAGAGACCACAAGGAGGGAATGG - Intergenic
917120964 1:171644310-171644332 AAGGGGCCAGATGCAGGGGAGGG - Intronic
922724776 1:227917752-227917774 AAGACCCCACATGCAGGGCAGGG + Intergenic
922962732 1:229662327-229662349 TGTGGTCCACAAGCAGGGCAAGG - Intergenic
923839386 1:237651745-237651767 AAAGGACCACAGGCCGGGCGCGG + Intronic
924639888 1:245823938-245823960 AAGGCACCGCACGCAGGGCAGGG + Intronic
1064002217 10:11673147-11673169 CAGGGACCACAAGCAGAAAAGGG + Intergenic
1064601134 10:16994520-16994542 AAGGGATAACAAACAGGGAAGGG + Intronic
1067202414 10:44184818-44184840 AAGGGAGCCCAGGAAGGGCAGGG + Intergenic
1068805614 10:61191385-61191407 AAAGGACCACAGGCAGGGGGAGG - Intergenic
1068827186 10:61453185-61453207 AAGGGACCACAAGCAGCAGCAGG - Exonic
1069374143 10:67776844-67776866 AAGAGGACACAACCAGGGCAAGG + Intergenic
1069610571 10:69769868-69769890 AAGGGACCCCAAGGAAGGCATGG + Intergenic
1071720921 10:88145533-88145555 AAAGGACCACATGCCTGGCAAGG - Intergenic
1072323299 10:94271962-94271984 AAGGGACAAAAGGCAGAGCAAGG + Intronic
1072871424 10:99124677-99124699 CAGGCACCAGAAGCATGGCAAGG + Intronic
1074057385 10:109934981-109935003 ATGGGACCACATGCTGGCCAGGG - Intergenic
1074465836 10:113680182-113680204 AAGGGAGGACAAGCTGAGCAAGG - Intronic
1074739926 10:116476194-116476216 AAGGTACCAGAAAAAGGGCACGG + Intronic
1075605577 10:123803400-123803422 AAGATACCACAGGCTGGGCATGG - Intronic
1075668747 10:124248745-124248767 AGGTGGCCACAAGCAGGGAAGGG + Intergenic
1075905681 10:126079827-126079849 AATGGACAACAGGCAAGGCAAGG + Intronic
1076076827 10:127540090-127540112 AAAGGGCCACAAGCAGGGATTGG - Intergenic
1076569651 10:131424289-131424311 ACTGGACAACAGGCAGGGCAAGG - Intergenic
1076588419 10:131566992-131567014 GACAGACCACAAGAAGGGCAAGG + Intergenic
1076751761 10:132546843-132546865 ACAGGACCAAAAGCAGGGCCAGG - Intronic
1077257835 11:1596823-1596845 GAAGGACCCCAGGCAGGGCAAGG - Intergenic
1077993670 11:7434378-7434400 AAGGAACCAAAAGCCAGGCAGGG + Intronic
1078127831 11:8585617-8585639 AATGGACCTCAGGCAGGGCTTGG + Intronic
1078520555 11:12059746-12059768 AAGGGACCCCAGGCTGGGCATGG + Intergenic
1078780974 11:14439179-14439201 AAGGGACCAGAAGTAGGTTATGG + Intergenic
1080595934 11:33774368-33774390 ATGGGACGACACGCATGGCAGGG - Intronic
1080667077 11:34345376-34345398 AAGGGGCCTGAAGGAGGGCAGGG - Intronic
1081868812 11:46374121-46374143 AAGGGACCAAAATGAGGGCTGGG - Intronic
1083172742 11:60932780-60932802 AAAGGACCACAAGTGGGGAAAGG - Intronic
1084199154 11:67543712-67543734 CAGGGTCCCCAAGCAGGGCTAGG - Intergenic
1084372958 11:68756632-68756654 AAGTGACAGCAAGGAGGGCAGGG - Exonic
1084804147 11:71567068-71567090 GAAGGACCCCAGGCAGGGCAAGG + Intronic
1085032463 11:73281055-73281077 AATGGAGCACAAACAGGGCTTGG + Intronic
1087093941 11:94302686-94302708 GAGGGAGGACAAGGAGGGCAGGG - Intergenic
1087337002 11:96856544-96856566 AGGGGACCAGAAACAAGGCAGGG + Intergenic
1089260372 11:117220078-117220100 AAGGACCCAATAGCAGGGCAGGG + Intronic
1090661871 11:128888271-128888293 CAGGGACCACAAGAAAGGGAAGG - Intergenic
1091339611 11:134800284-134800306 AAGAGACCAAGAGCAGGCCACGG - Intergenic
1092196567 12:6553144-6553166 AAGAGACCAGAATGAGGGCAGGG + Intronic
1092260509 12:6951243-6951265 AAGGGAAGAGAAGCAGAGCAGGG - Intronic
1093069451 12:14693315-14693337 AAGGGAGCACACACAGGGTATGG + Intronic
1095910021 12:47416764-47416786 AAGAGACCCCAGGCTGGGCACGG + Intergenic
1096689639 12:53312035-53312057 AAGGGAGGACAGGCCGGGCATGG + Intronic
1096709342 12:53443752-53443774 CAAGTACCACAAGCATGGCAAGG + Exonic
1096718925 12:53506989-53507011 AAAGGGACACAAGCATGGCAGGG - Intronic
1097195123 12:57238857-57238879 CAGGGACCAGAAGCAGGAGAAGG - Intronic
1098208527 12:68137691-68137713 ATGGTACCACAAGCAGTGCCAGG - Intergenic
1098461181 12:70734641-70734663 CAGGGACCACAAGTAGAGAAAGG + Intronic
1100859299 12:98787627-98787649 AAGGAACCACAGGCTGGGCGTGG + Intronic
1101425466 12:104584545-104584567 AAGTGAAAACAGGCAGGGCATGG - Intronic
1101998924 12:109544616-109544638 AGGGGACCACATGGAGTGCATGG - Intergenic
1104372070 12:128232258-128232280 AAGGGAGCAAAGGAAGGGCAAGG + Intergenic
1104753793 12:131256357-131256379 AAAGGACAACAGGCAGGGCTTGG - Intergenic
1104778899 12:131407174-131407196 AAAGGACAACAGGCAGGGAAGGG + Intergenic
1104893401 12:132150822-132150844 TGGAGACCACATGCAGGGCAGGG - Intronic
1105221537 13:18333325-18333347 AAGGGATCTCAAGGAGAGCAGGG + Intergenic
1105790022 13:23789704-23789726 GAGGGTCAACAAGAAGGGCATGG - Intronic
1106229131 13:27808217-27808239 AAAGTACCACATGCAGGGCCAGG - Intergenic
1106665607 13:31847295-31847317 ACGTGCCCACACGCAGGGCACGG - Intergenic
1107730867 13:43347065-43347087 AAGCGACCACAAGCAAGAGAAGG - Intronic
1110239389 13:73250072-73250094 CAGGGAGCTCAGGCAGGGCATGG + Intergenic
1110275224 13:73635045-73635067 CAGGGAGCAGAAGCAGGGCTGGG - Intergenic
1110810571 13:79807543-79807565 CAGGCACCACAAGCAAGGAAAGG - Intergenic
1111659711 13:91193784-91193806 AAGGGAAGCAAAGCAGGGCAGGG - Intergenic
1111722506 13:91964315-91964337 AAGGGAATAAAAGCAGGCCACGG - Intronic
1113728408 13:112622730-112622752 AAGGAGCCACAAGCTGGGCCAGG + Intergenic
1115442937 14:33456903-33456925 AAGGCAACTCAAGCAGGGGAAGG + Intronic
1117359660 14:54960456-54960478 AAGAGACTACAAGCTGGGCGTGG - Intronic
1117686592 14:58259712-58259734 AAGGGACAACAATTAGGGAACGG + Intronic
1117962394 14:61176351-61176373 TAAGCATCACAAGCAGGGCATGG - Intergenic
1118280668 14:64425499-64425521 AAGGGAAAACAGGCCGGGCACGG - Intronic
1118774012 14:68962190-68962212 AAGAGCCCACATCCAGGGCACGG + Intronic
1119319304 14:73719979-73720001 CAGGGACACCAAACAGGGCAAGG + Intronic
1121530764 14:94651630-94651652 GAGGGAGGGCAAGCAGGGCAGGG + Intergenic
1122752170 14:103944853-103944875 AAGGGAAAAGAAGCCGGGCACGG - Intronic
1122839096 14:104446107-104446129 AAGGGGCCCCAAGCACAGCAGGG - Intergenic
1122994134 14:105253477-105253499 AAGGGCCCACGAGCCGGGCTTGG - Intronic
1123063802 14:105606274-105606296 CCAGGGCCACAAGCAGGGCATGG - Intergenic
1126420815 15:48470210-48470232 TGGTGACCACGAGCAGGGCAGGG + Intronic
1127295987 15:57608863-57608885 AAGGGACTCCAAGCATGGCTAGG - Intronic
1128138599 15:65282804-65282826 AAGGGATTACAAGTGGGGCAAGG + Intronic
1129922243 15:79329204-79329226 AAGAGACAACAACCAGGGCCTGG + Intronic
1130942291 15:88521157-88521179 GAGGGACAACAAGAAGGCCAGGG - Intronic
1131453113 15:92562662-92562684 GCTGGACCACAGGCAGGGCAAGG + Intergenic
1131537316 15:93248349-93248371 AAGACACCCCAAGCCGGGCACGG + Intergenic
1132000964 15:98179737-98179759 AAGGAACCACAGGCCGGGCGCGG - Intergenic
1132608169 16:802103-802125 CAGGGGGCACAGGCAGGGCAGGG - Intergenic
1132956968 16:2599449-2599471 CAGGAACCACAGGCAGGGCCTGG - Exonic
1132969319 16:2677902-2677924 CAGGAACCACAGGCAGGGCCTGG - Intergenic
1134006802 16:10823304-10823326 AAGGGAACTCAGGCAGGGCATGG + Intergenic
1135958963 16:26979895-26979917 CAGGGCCCCCAAGCTGGGCATGG + Intergenic
1137461553 16:48668611-48668633 AAGTGAACTAAAGCAGGGCAAGG - Intergenic
1137760348 16:50935391-50935413 CAGGAAGCACAAGCAAGGCAGGG - Intergenic
1139429632 16:66904231-66904253 CAGGGCCCACAAGCAGGGCAAGG + Intergenic
1140407027 16:74717876-74717898 AAGGCTTCACAAACAGGGCAAGG + Intronic
1140911549 16:79457777-79457799 AAGGCACCCCAAGAAGGTCATGG + Intergenic
1141205079 16:81927270-81927292 CAGAGACCACAAGCAGCACATGG - Intronic
1142889327 17:2932847-2932869 CAGGGACCACGGGCAGGGTATGG + Intronic
1143025871 17:3941762-3941784 AAGGGTACACACGCAAGGCAGGG + Intronic
1143392036 17:6564988-6565010 ATGGGAACACAAGAAGTGCACGG - Intergenic
1143619532 17:8073091-8073113 AGGGGACCAGAAGCCGGGGATGG - Intronic
1144630782 17:16871133-16871155 AAGGGCCCAAGAGCATGGCATGG + Intergenic
1144835733 17:18155789-18155811 AAGGGACTTCTAGCAGGGGAGGG - Intronic
1144995522 17:19265559-19265581 AAAGGGCCAAGAGCAGGGCAGGG - Intronic
1146663808 17:34683348-34683370 AAGAGGCCCCAAGCAGGGGAGGG - Intergenic
1147449673 17:40496237-40496259 AGGGGGCCCCATGCAGGGCACGG + Exonic
1147583536 17:41639633-41639655 AAGGGAGGAGAAGCAGGGCAGGG + Intergenic
1147617853 17:41840823-41840845 AAGGAAGCAAAAGCCGGGCATGG + Intronic
1150020855 17:61611186-61611208 AAGGGGCAACAAGGAGGGAAAGG + Intergenic
1151152425 17:72099390-72099412 AAGGGACCACAAACGGGGTGGGG + Intergenic
1151299919 17:73216550-73216572 AAGAGCCCACTAGCAGGCCAGGG + Intronic
1151984173 17:77531473-77531495 TAGTGACCACAAGGATGGCAGGG - Intergenic
1152477394 17:80527013-80527035 AAGGGTCCACAAGCAAGACATGG - Intergenic
1154414691 18:14170725-14170747 ACAGGGCCAGAAGCAGGGCAGGG + Intergenic
1155593201 18:27452400-27452422 CTGGGACCACCAGCAGAGCAGGG - Intergenic
1155652780 18:28160950-28160972 AAGGCACCTCAAGAAGGACAAGG - Intronic
1156312681 18:35939288-35939310 CAGGAACCACAAGCAGGGAAGGG + Intergenic
1159334014 18:67039787-67039809 AAGGGAAGACAAAGAGGGCATGG - Intergenic
1159388428 18:67757511-67757533 AAGAAACCACAAGCAGGGCCAGG + Intergenic
1160518611 18:79491691-79491713 CAGGGACAACAAGCCTGGCATGG + Intronic
1161204622 19:3034526-3034548 AAGAGATAACAAGCAGGGAAAGG - Intronic
1161210538 19:3062999-3063021 CAGGCACCACCACCAGGGCAGGG - Exonic
1161510461 19:4667900-4667922 AAGGTATCACAGGCAAGGCATGG - Intronic
1161916619 19:7233282-7233304 AAGGTATCACAGGCTGGGCATGG - Intronic
1162188188 19:8923265-8923287 AGGGGACCAGAAGCAGGTTAGGG + Intronic
1162208865 19:9076000-9076022 AGGGAACCAGAAGGAGGGCAAGG - Intergenic
1162394632 19:10409815-10409837 AAGAAAACACAAGCAGGGCTGGG + Intronic
1162453778 19:10770092-10770114 ACGGGACCACACGCAGGGCCTGG + Intronic
1162494428 19:11015462-11015484 AAGGCACATCAAGCAGGGCGTGG - Intronic
1163269285 19:16241028-16241050 AAGGTAGGACAAGCCGGGCATGG + Intronic
1163446730 19:17351494-17351516 AACGGGCCACAGGCAGGGCTGGG + Exonic
1165655191 19:37526665-37526687 GCAGGACCAAAAGCAGGGCAGGG - Intronic
1165712180 19:38019674-38019696 AAGTGACCAGAATCAGAGCACGG + Intronic
1167597341 19:50434765-50434787 AAGGAACAGCAGGCAGGGCAGGG + Intronic
925187702 2:1860471-1860493 AAGGGACCTCACTCAGGGCTGGG + Intronic
926794194 2:16605550-16605572 AAGGTACCCCATGCAGGGCAAGG + Intronic
927694997 2:25233704-25233726 ATAGGAGCACAAGCAGGGGACGG - Exonic
928022176 2:27713926-27713948 AAATGACCACAGGCCGGGCACGG + Intronic
928457916 2:31440447-31440469 AAGCAACCACAGGCAGGGCGCGG + Intergenic
929075935 2:38078685-38078707 AAGGCATCACAGGCCGGGCACGG - Intronic
930305526 2:49670209-49670231 AAGGGACCACTGGCCGGGCGCGG + Intergenic
932574712 2:72956286-72956308 AAGGGCCAACAGGTAGGGCAGGG - Intronic
932629606 2:73327852-73327874 AAGAGACAACAGGCTGGGCATGG - Intergenic
933498708 2:83085080-83085102 AAGGGATCAGAAGCATGGCTGGG + Intergenic
933542170 2:83660333-83660355 AAGCTACCACAGGCCGGGCATGG - Intergenic
934182512 2:89639129-89639151 AAGGGATCTCAAGGAGAGCAGGG - Intergenic
934292808 2:91713332-91713354 AAGGGATCTCAAGGAGAGCAGGG - Intergenic
936144776 2:109973330-109973352 AAGAGAACATAAGCAGGGCCAGG - Intergenic
936181462 2:110271293-110271315 AAGAGAACATAAGCAGGGCCAGG - Intergenic
936199910 2:110398139-110398161 AAGAGAACATAAGCAGGGCCAGG + Intergenic
937716372 2:125037755-125037777 AAGGGAATAAAAGCAGGCCAGGG + Intergenic
937895430 2:126973921-126973943 CAGGGAGCACAGGCAGGGCCTGG - Intergenic
938403796 2:131015987-131016009 CAGGGACCACATGCATGCCAGGG + Intronic
938966981 2:136397404-136397426 AAAGGATCACAAGCACAGCATGG - Intergenic
941063813 2:160878352-160878374 GAAGGACCACAAGCAGGGCAGGG - Intergenic
942478639 2:176357801-176357823 AAGGGAACCCAAGTAGGGCCTGG - Intergenic
942617910 2:177813726-177813748 AAGGGAGCACAAGTAGTTCATGG - Intronic
942981694 2:182091712-182091734 AAAGAAAAACAAGCAGGGCATGG - Intronic
943569568 2:189557144-189557166 AAGTGATCTCAAGCAGGACATGG - Intergenic
947624921 2:231613361-231613383 AAGGGATGTCAAGCAGGACAGGG - Intergenic
948412526 2:237775138-237775160 AAGTGACCACAGGCAGGAGAGGG + Intronic
948420472 2:237857122-237857144 AGTGGACCACAAGAAGTGCAGGG - Intergenic
948552824 2:238785889-238785911 CAGGGGCCAGAAGCAGGGCCTGG + Intergenic
1170380921 20:15758857-15758879 AAAGGACCCCAGGCCGGGCACGG + Intronic
1170699874 20:18694378-18694400 AAGGGACCAACTGCAAGGCACGG - Intronic
1171978369 20:31609678-31609700 AAGTGAACACAGGCCGGGCACGG - Intergenic
1172221319 20:33276931-33276953 AATGGAGCACAAGCAGGGCTGGG - Intronic
1173633857 20:44537522-44537544 AACTGAACACAGGCAGGGCACGG - Intronic
1174611003 20:51798923-51798945 ATGGGCCATCAAGCAGGGCAAGG + Intronic
1174919797 20:54689535-54689557 AAGGTACTACAAGCCTGGCATGG - Intergenic
1175190269 20:57207233-57207255 AAGAGACCACATGGAGGGGAAGG + Intronic
1175942010 20:62541802-62541824 CAAGGACCACAGGCAGGGAAGGG - Intergenic
1175977589 20:62719089-62719111 AAGGGACTGGAAGCAAGGCAAGG - Intronic
1176729956 21:10484124-10484146 AAGGGATCTCAAGGAGAGCAGGG + Intergenic
1176858330 21:13987529-13987551 ACAGGGCCAGAAGCAGGGCAGGG - Intergenic
1179129032 21:38617942-38617964 AAGAGACCACAGGCAGGACAAGG + Intronic
1179660747 21:42873254-42873276 GAGGGACCAGCAGCAGGGCCCGG + Intronic
1180943562 22:19676825-19676847 AACAGAAAACAAGCAGGGCATGG + Intergenic
1181354827 22:22291627-22291649 AAGAGGGCACAGGCAGGGCAGGG + Intergenic
1181696614 22:24595824-24595846 AAGGGCCCAGAGGCAGTGCAAGG - Intronic
1183836779 22:40460906-40460928 AATAGACCCCAAGCCGGGCAAGG + Intronic
1185069979 22:48650866-48650888 AAAGGAGCAGAAGCAGGGCCTGG - Intronic
949606441 3:5659208-5659230 AAGGGAATAAAAGCAGGCCAGGG - Intergenic
949843769 3:8350164-8350186 AATGGACCAACAGCAGGACATGG - Intergenic
950426013 3:12925099-12925121 AAGGGGCTGCAGGCAGGGCAGGG - Intronic
952279227 3:31907336-31907358 AAGTGACCTCTAGCTGGGCACGG + Intronic
952380937 3:32804712-32804734 ATAGAACCACAAGCTGGGCATGG + Intergenic
952702863 3:36344137-36344159 AAGGGACCCCAGGTAGGGGAGGG - Intergenic
953029305 3:39168005-39168027 AAGGGGATACAAGCAGGGCATGG - Intergenic
953050205 3:39334767-39334789 AAACAACCACAAGCTGGGCACGG + Intergenic
953350017 3:42208473-42208495 AAGGGAACACAGGCAGGCCGAGG - Intronic
953374034 3:42413591-42413613 AGGGGGCTACCAGCAGGGCAGGG + Intergenic
953741386 3:45541992-45542014 TAGGGGCCACCAGCAGGGCAGGG - Intronic
953897093 3:46811214-46811236 CAGGGAAGTCAAGCAGGGCAAGG + Intronic
954239152 3:49279969-49279991 AAATGAACACAGGCAGGGCACGG + Intronic
955208472 3:56918585-56918607 AAGGAAGCAAAAACAGGGCACGG + Intronic
955370524 3:58347387-58347409 CAGGGACCAGAAGGAGGGCAGGG - Intronic
957913966 3:86662045-86662067 AAGGGAGCATCTGCAGGGCAGGG + Intergenic
960107970 3:113818322-113818344 AAGGGAGCAAAAGCAGGGTTGGG + Intergenic
960155947 3:114297435-114297457 CTGGGACAATAAGCAGGGCAGGG + Intronic
961204339 3:125068976-125068998 CAGGGACCCCAGGCAGGGCTTGG - Intergenic
961606367 3:128098503-128098525 AAGTGCCCACAAACTGGGCAGGG + Intronic
961617550 3:128194738-128194760 AAGTGAAAAAAAGCAGGGCAAGG + Intronic
965841192 3:172907516-172907538 AAGGAACAGCAAGCAGGGTAGGG - Intronic
968004015 3:195226965-195226987 CAGGGTCCACAAGCAGGGGATGG + Intronic
968502973 4:959762-959784 AAGGGACCAAAAGCAGGGCATGG - Exonic
968564054 4:1300337-1300359 AAGGGACACCAAGAAGGGCTGGG + Intronic
968975455 4:3820083-3820105 AGGGGTCCAGAGGCAGGGCAGGG - Intergenic
969426954 4:7130074-7130096 AGGGGACAACTGGCAGGGCAGGG + Intergenic
969673185 4:8601029-8601051 AGGGGACCCCACGCAGGGCCAGG - Intronic
970422614 4:15919471-15919493 AAGGGGCCCCAGGTAGGGCAGGG - Intergenic
970616707 4:17774449-17774471 ACGGGCCCAGAGGCAGGGCAGGG + Intronic
972833151 4:42837003-42837025 AACGGAGGAGAAGCAGGGCAGGG + Intergenic
974298482 4:60034799-60034821 CAGGGAGCAGAAGCAGGGTAGGG - Intergenic
976326981 4:83782850-83782872 GAGGGAGGAGAAGCAGGGCATGG + Intergenic
976709865 4:88057722-88057744 AAGAAAACACAAGCTGGGCACGG - Intronic
980306365 4:131065472-131065494 AGGGCACCAGAAGCAGGGAAAGG + Intergenic
980885558 4:138758744-138758766 AAAGGCCCAGAATCAGGGCAGGG + Intergenic
981614325 4:146631207-146631229 AAGTGATCACAAACAGGGAAAGG + Intergenic
985577755 5:681616-681638 ATGGGACCACAAGTGGGGCCTGG + Intronic
986325933 5:6674567-6674589 AAGGCACCAGAAGCAGCTCATGG - Intergenic
987093680 5:14529640-14529662 CAGGGACCACATTCTGGGCAGGG - Intronic
988076910 5:26365046-26365068 AAGGGACTACTTGCTGGGCATGG - Intergenic
989757719 5:44975692-44975714 AAGGGAATAAAAGCAGGCCACGG + Intergenic
994070766 5:95599410-95599432 GAGGCACCACCAGCAAGGCATGG - Intronic
995334137 5:110979389-110979411 AAGGGACCAGGAGCAAAGCATGG - Intergenic
996111521 5:119571521-119571543 AAGGGGCCACAAGTCTGGCAGGG + Intronic
996700807 5:126448340-126448362 AAGGGACCACAGAGAAGGCATGG + Intronic
997154199 5:131534964-131534986 GAAGGACCTCAAGCTGGGCAAGG + Intronic
998644536 5:144047934-144047956 GAGTGACCAGAAGCAGGGTAGGG + Intergenic
1000281614 5:159787194-159787216 CAGGGCCGACAAGCAGGACAAGG + Intergenic
1002210797 5:177598057-177598079 AAGAGACCACAGGCTGGGCATGG + Intergenic
1002886994 6:1306280-1306302 AAGTGAGCACAAGGAGGGGAGGG - Intergenic
1004018531 6:11754801-11754823 AAGCAACCAGAAGCATGGCAGGG + Intronic
1004421264 6:15472236-15472258 GAGGGACAGCAAGGAGGGCAAGG - Intronic
1004755813 6:18608961-18608983 AAGGGAACTCAAGCAGGTCATGG - Intergenic
1006163024 6:32049064-32049086 AAGCTACAACAAACAGGGCATGG + Intronic
1012945870 6:105464948-105464970 AGGGGACTACAAGCAGGGGCTGG + Intergenic
1013378468 6:109542290-109542312 AAGTTACCACAGGCAGGGAAGGG + Intronic
1013487749 6:110614306-110614328 AATGGAACACATGCAGGGAAGGG + Exonic
1016173264 6:141046292-141046314 AGGGGACTACAAGAAGGGGAAGG - Intergenic
1016708126 6:147137722-147137744 AAAGGACCTTAAGTAGGGCATGG + Intergenic
1017983047 6:159419515-159419537 AAGGGATGACAAGCATGACAGGG + Intergenic
1018402070 6:163433474-163433496 AATGAACCACAGGCCGGGCACGG + Intronic
1019308693 7:348381-348403 AAGGGACCCCCAGCAGGGACTGG - Intergenic
1019931430 7:4225925-4225947 AAGGGAACCCAAGCAGGCCGCGG + Intronic
1019961205 7:4461408-4461430 AGGGAACCACAAGATGGGCAGGG - Intergenic
1020806481 7:12795903-12795925 AGGGGACAAATAGCAGGGCAAGG - Intergenic
1024720041 7:52126081-52126103 AGGGAACAACAAGCAGGGAATGG - Intergenic
1025619687 7:63157272-63157294 AAAAGAAGACAAGCAGGGCATGG + Intergenic
1026235048 7:68520206-68520228 GAGAGAAGACAAGCAGGGCAGGG - Intergenic
1027344638 7:77245374-77245396 AAGGTAACACAATCAAGGCAAGG - Intronic
1034106481 7:148495010-148495032 TAGTCACCACAAGAAGGGCAAGG - Intergenic
1034599620 7:152237409-152237431 AAGGGATCTCAAGGAGAGCAGGG - Intronic
1035472487 7:159119326-159119348 AAGTGATCACAAGCACCGCAAGG + Intronic
1035868514 8:3111539-3111561 ATGGGACCATAGGCTGGGCACGG + Intronic
1036908532 8:12731104-12731126 AAGGGACAACAAGCAATGCCTGG + Intronic
1037085041 8:14838175-14838197 AAGGGAGCAAAAAGAGGGCATGG + Intronic
1037459592 8:19095490-19095512 AATGGGCCACAGGCAGGCCAAGG + Intergenic
1037573658 8:20180396-20180418 AAAGAACCACAAGGAAGGCAAGG + Intronic
1037610694 8:20473715-20473737 AAGGGACTCCAGGCCGGGCATGG + Intergenic
1037724500 8:21472311-21472333 ATGAGACCACAAGCAGAGGAAGG + Intergenic
1038367017 8:26946695-26946717 ACGGAACCACAGGCCGGGCATGG - Intergenic
1039329691 8:36523569-36523591 AAGGCAGCACATGCAAGGCAGGG + Intergenic
1041011362 8:53547157-53547179 AGGAGACCACAAGCAGGTCCAGG + Intergenic
1041525860 8:58804738-58804760 CATGGACCACAAGCAGTCCATGG - Intergenic
1042217348 8:66439433-66439455 GAGGGACCACAGCCAGGGGAGGG + Intronic
1047464980 8:125104278-125104300 AGAGGACAACAAGCTGGGCATGG - Intronic
1048327705 8:133451830-133451852 AAGGGACCTCAGGCAGGCAAGGG - Intergenic
1048558356 8:135505364-135505386 AAGGGACCACAAGCAGGGCAGGG - Intronic
1052213470 9:25935823-25935845 ATGGAACCACAACCAGTGCAGGG + Intergenic
1052316764 9:27123406-27123428 AAGGGACCACATGCAGGGGAAGG - Intronic
1056335450 9:85564056-85564078 AAGGAACCACCACAAGGGCAAGG + Intronic
1057406232 9:94773307-94773329 CAGGGAAAACAAGCAGGGGATGG + Intronic
1059115961 9:111600048-111600070 AAGGGTCCAAAGGCAGGGCCTGG + Intergenic
1059978110 9:119739342-119739364 AAGTGACCGCCAGCTGGGCATGG - Intergenic
1060828565 9:126700076-126700098 GAGGGACAAAAAGCTGGGCATGG + Exonic
1061081119 9:128371081-128371103 ACGGGACCACAAGCAGGCGGAGG - Intergenic
1062273415 9:135719999-135720021 AGTGGACCACAAACAGGGCCCGG + Intronic
1203584323 Un_KI270746v1:49949-49971 AAGGGATCTCAAGGAGAGCAGGG - Intergenic
1187267323 X:17747195-17747217 AAGGGGTCAGAAGAAGGGCAGGG - Intronic
1187825671 X:23332667-23332689 TAGGGAGCACAAGCAGAGCAGGG + Intergenic
1188551434 X:31368934-31368956 AAGGGACCTCGGGCCGGGCATGG - Intronic
1190574383 X:51818329-51818351 ATGGCACTACAAGCTGGGCATGG + Intronic
1190885858 X:54530448-54530470 AAGGGACCGGAAGAGGGGCAGGG + Intronic
1191067811 X:56368510-56368532 AGGAGACCACAGGCTGGGCATGG - Intergenic
1191889649 X:65926881-65926903 CAGAGAACAAAAGCAGGGCAGGG - Intergenic
1192074632 X:67980528-67980550 AAGGGTCCACAGGGAGGGAAGGG + Intergenic
1193150343 X:78118289-78118311 AAGGAACTACAGGCTGGGCATGG + Intronic
1195371771 X:104182774-104182796 AAGGGTCCAAAACCATGGCAAGG + Intronic
1198687915 X:139247577-139247599 AAGGGAACACAAGAAGGGAAAGG - Intergenic
1199879865 X:151965472-151965494 CAAGTACCACAAGCAGGCCAAGG + Intronic