ID: 1048558357

View in Genome Browser
Species Human (GRCh38)
Location 8:135505365-135505387
Sequence CAAGGGACCACAAGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558357_1048558364 2 Left 1048558357 8:135505365-135505387 CCTGCCCTGCTTGTGGTCCCTTG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1048558364 8:135505390-135505412 ACCCTTGAGAGCTCTCCTTCAGG No data
1048558357_1048558366 3 Left 1048558357 8:135505365-135505387 CCTGCCCTGCTTGTGGTCCCTTG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558357_1048558369 19 Left 1048558357 8:135505365-135505387 CCTGCCCTGCTTGTGGTCCCTTG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558357 Original CRISPR CAAGGGACCACAAGCAGGGC AGG (reversed) Intronic
900178290 1:1300278-1300300 CAGGGAACCACAAGCAGCTCAGG - Intronic
900496649 1:2978837-2978859 CCAGGGCCACCAAGCAGGGCTGG + Intergenic
901012641 1:6210174-6210196 CAGGGGGCCAGGAGCAGGGCCGG - Intronic
901823532 1:11845977-11845999 CCAGGGAGGACAAGCAGGGCTGG - Exonic
901961180 1:12827912-12827934 AGAGGGACAACAAGCAGGGAGGG - Intronic
902017400 1:13319268-13319290 AGAGGGACAACAAGCAGGGAGGG + Intronic
902989453 1:20176213-20176235 GAAGGGAACACATGCTGGGCCGG - Intronic
903250298 1:22048388-22048410 CATGGGCAGACAAGCAGGGCAGG + Intergenic
903559414 1:24216541-24216563 CAAGGAACCAGAGCCAGGGCAGG - Intergenic
903830181 1:26169939-26169961 CAAGGGGCCAGGAGCAGGGCAGG - Exonic
904326470 1:29729789-29729811 CACGTGAGCACCAGCAGGGCAGG - Intergenic
907585693 1:55615922-55615944 CAAGGGAGAAAAAGCAGAGCAGG + Intergenic
909751967 1:79172611-79172633 CAAAGGAACAAAAGCAGGGGAGG - Intergenic
912449559 1:109760756-109760778 CAATGGAGAACAAGCAGGGAGGG - Intronic
912546860 1:110457252-110457274 CAAGGGACAGGGAGCAGGGCAGG + Exonic
915117145 1:153608269-153608291 CCAGGGACCAGAAACAAGGCAGG - Intronic
915280024 1:154816127-154816149 CAAGGGACCAAAAAAAGGGGAGG - Intronic
916717167 1:167455669-167455691 CAAGGGACCGCAAGTGGGGGCGG - Intronic
917722673 1:177800838-177800860 CAAGGGAGAGCAAGCAGGGCAGG - Intergenic
918111316 1:181457604-181457626 CTAGGCACAACAAGCAGGGCTGG + Intronic
920147004 1:203870569-203870591 AAAAGGACCACAAGCATAGCTGG + Intergenic
920366669 1:205451487-205451509 CAAGGGCAGGCAAGCAGGGCGGG - Intronic
921588226 1:216973485-216973507 CCAGGGCCCAGAAGCAGTGCTGG + Intronic
922494586 1:226046665-226046687 CAATCGACCACCAGCATGGCTGG - Intergenic
924387035 1:243508597-243508619 CCAGGGCCCAGGAGCAGGGCAGG + Intronic
924639887 1:245823937-245823959 GAAGGCACCGCACGCAGGGCAGG + Intronic
924925169 1:248672144-248672166 CAAGGGTCCACATGCAGCGAGGG - Intergenic
1067040857 10:42952440-42952462 CATGGGCCCACAGGCGGGGCAGG + Intergenic
1067202413 10:44184817-44184839 CAAGGGAGCCCAGGAAGGGCAGG + Intergenic
1069656117 10:70090090-70090112 CGAGGGACAACAAGAAGGCCCGG + Exonic
1070761643 10:79027792-79027814 CACGGTAGCACATGCAGGGCAGG + Intergenic
1071960483 10:90804870-90804892 GAAGGGACCAAAAGAAGGGGAGG + Intronic
1075405358 10:122192214-122192236 CAAGGGACCACAAAGAGGCTTGG + Intronic
1076126429 10:127977874-127977896 CCAGGGAACAGAAGCAGGGAGGG - Intronic
1077483419 11:2827156-2827178 TAAGGGACCAGAGTCAGGGCAGG + Intronic
1077648332 11:3946532-3946554 CAACGAAGAACAAGCAGGGCAGG - Intronic
1079098586 11:17526910-17526932 CACTGGCCCAGAAGCAGGGCTGG + Intronic
1081868813 11:46374122-46374144 CAAGGGACCAAAATGAGGGCTGG - Intronic
1083711665 11:64553571-64553593 CAAGGGTCCTCAGGCAGGGGTGG - Intergenic
1084506249 11:69570213-69570235 CCAGGGCCCCCAAGAAGGGCTGG - Intergenic
1084520279 11:69658401-69658423 CGAGGGCACACAAGGAGGGCTGG + Intronic
1084736550 11:71109076-71109098 GCAGGGGCCAGAAGCAGGGCTGG + Intronic
1085637587 11:78170327-78170349 CAGGGGACCACACCTAGGGCAGG + Intergenic
1086624583 11:88931542-88931564 GAAGAAACCAAAAGCAGGGCTGG + Intronic
1087822377 11:102726978-102727000 CCAGGGACCAGAAGCAGGTGAGG - Intronic
1088033023 11:105275293-105275315 CAAGGGCCCACAACCACGCCCGG - Intergenic
1092170419 12:6370701-6370723 CTGGGGACCACAGGCAGGGACGG + Intronic
1092257334 12:6934493-6934515 CAAAGGTCAACAAGCAGGGTCGG + Exonic
1092260510 12:6951244-6951266 CAAGGGAAGAGAAGCAGAGCAGG - Intronic
1096512479 12:52138812-52138834 CAAGGAACCACAAACAGCCCTGG - Intergenic
1099376219 12:81898581-81898603 CAAGGGACCACAAAAACTGCTGG + Intergenic
1100029002 12:90163268-90163290 CAAGGGAACACAAGCATTGTTGG - Intergenic
1100320044 12:93482296-93482318 CAAAGGACAACAAGGAGTGCAGG - Intronic
1100379884 12:94051597-94051619 CAAGGAACTACAAGAAGGCCAGG - Intergenic
1101518708 12:105462025-105462047 GAAGGGGACACAAGCAGGGGGGG - Intergenic
1104040692 12:125128441-125128463 CTAGGGACCAGAAGCCCGGCGGG - Intronic
1104762227 12:131304362-131304384 CATGAGGCCACAAGGAGGGCTGG + Intergenic
1104778898 12:131407173-131407195 CAAAGGACAACAGGCAGGGAAGG + Intergenic
1104817549 12:131656434-131656456 CATGAGGCCACAAGGAGGGCTGG - Intergenic
1104855536 12:131900779-131900801 CCCAGGACCCCAAGCAGGGCTGG - Intronic
1104893402 12:132150823-132150845 CTGGAGACCACATGCAGGGCAGG - Intronic
1105647010 13:22331556-22331578 GAAGAGACCAGAGGCAGGGCAGG - Intergenic
1106294630 13:28400019-28400041 CAAAGGACCACAGACAGGCCTGG + Intronic
1106308171 13:28531980-28532002 CAGGGGAGCAGAGGCAGGGCAGG - Intergenic
1106907079 13:34420425-34420447 CAAAGCACCACAAACTGGGCCGG + Intergenic
1107081157 13:36376418-36376440 CACGGTACCCCACGCAGGGCAGG - Intergenic
1107609520 13:42099197-42099219 CAAAGAAACACAAGCAGGACAGG - Intronic
1107725650 13:43296474-43296496 CTAGGGTCCAAAAGCAGGGGTGG - Intronic
1110275225 13:73635046-73635068 GCAGGGAGCAGAAGCAGGGCTGG - Intergenic
1113485109 13:110647334-110647356 CCAGGGACCACACGGAGAGCGGG + Intronic
1114702241 14:24690823-24690845 CAAGGGCCCACACACAGGGCAGG - Intergenic
1114756797 14:25269133-25269155 CAAGAGACCACTAGCAGTGGTGG + Intergenic
1121921367 14:97884867-97884889 CAAAGGACCACAGGCTGAGCTGG + Intergenic
1122981678 14:105195014-105195036 CAAGGGACAAGCAGCTGGGCTGG + Intergenic
1123954458 15:25320302-25320324 CAAGGGCCCACAACCACGCCTGG - Intergenic
1126420814 15:48470209-48470231 CTGGTGACCACGAGCAGGGCAGG + Intronic
1130085344 15:80773951-80773973 CAATGGAAGACAAGCAGGGTTGG + Intergenic
1130903374 15:88223528-88223550 CCAGGGGCCAGAAGCAGGCCTGG + Intronic
1132608170 16:802104-802126 CCAGGGGGCACAGGCAGGGCAGG - Intergenic
1132657213 16:1046372-1046394 CACGGGCCCAGGAGCAGGGCGGG - Intergenic
1134522191 16:14923911-14923933 GGAGGGACGCCAAGCAGGGCAGG + Intronic
1134709861 16:16322562-16322584 GGAGGGACGCCAAGCAGGGCAGG + Intergenic
1134949742 16:18346083-18346105 GGAGGGACGCCAAGCAGGGCAGG - Intergenic
1135305982 16:21368087-21368109 CAGGGAACCAAAAGCAGGGATGG - Intergenic
1136302722 16:29347239-29347261 CAGGGAACCAAAAGCAGGGATGG - Intergenic
1137227234 16:46524750-46524772 CAAGAGACAACAAGCTGGGTGGG - Intergenic
1137760349 16:50935392-50935414 CCAGGAAGCACAAGCAAGGCAGG - Intergenic
1138961899 16:62037248-62037270 GAAGTGACCACAGACAGGGCAGG - Intergenic
1141086235 16:81097217-81097239 CCAGGGACCCCAAACAGGACCGG + Intergenic
1141599807 16:85118795-85118817 CAGGGGACCACAATCAGGCTGGG + Intergenic
1143025870 17:3941761-3941783 CAAGGGTACACACGCAAGGCAGG + Intronic
1144149025 17:12425505-12425527 CATGGTCCCACAAGCAGGGCAGG + Intergenic
1146585273 17:34076845-34076867 GAAGGGCACAGAAGCAGGGCTGG + Intronic
1146663809 17:34683349-34683371 CAAGAGGCCCCAAGCAGGGGAGG - Intergenic
1147405557 17:40209322-40209344 AAAGGGACCACAAGGATGGCTGG + Intergenic
1147565454 17:41533547-41533569 AGAGGGACCGTAAGCAGGGCTGG + Intergenic
1147583535 17:41639632-41639654 CAAGGGAGGAGAAGCAGGGCAGG + Intergenic
1148141742 17:45333889-45333911 CCAGGGAACACCAGCAGGGGTGG + Intergenic
1151152424 17:72099389-72099411 CAAGGGACCACAAACGGGGTGGG + Intergenic
1151621051 17:75245220-75245242 CCAGGGACCACAGGCAGCACAGG - Intronic
1151724775 17:75877621-75877643 CAGGGGACCTGAAGCCGGGCCGG - Intronic
1151984174 17:77531474-77531496 CTAGTGACCACAAGGATGGCAGG - Intergenic
1152495539 17:80668761-80668783 CCAGGGATCACAGGCAGAGCGGG + Intronic
1154405011 18:14082966-14082988 CAAGAGATCAAAACCAGGGCAGG - Intronic
1155593202 18:27452401-27452423 CCTGGGACCACCAGCAGAGCAGG - Intergenic
1156312680 18:35939287-35939309 ACAGGAACCACAAGCAGGGAAGG + Intergenic
1157811833 18:50702826-50702848 CAGAGTACCACAAACAGGGCCGG + Intronic
1158448545 18:57542709-57542731 CAAGAGACCTCAAGGAGGGATGG - Intergenic
1160154412 18:76422666-76422688 CAAGGGGCAAGAAGCAGGGACGG + Intronic
1161210539 19:3063000-3063022 CCAGGCACCACCACCAGGGCAGG - Exonic
1162182761 19:8882007-8882029 CAAGGGACCAGTAGAAGGGGTGG + Intronic
1162394631 19:10409814-10409836 AAAGAAAACACAAGCAGGGCTGG + Intronic
1163007407 19:14405677-14405699 AAAGGGACCACAAAGAGGGCAGG + Intronic
1163446729 19:17351493-17351515 CAACGGGCCACAGGCAGGGCTGG + Exonic
1163725262 19:18919727-18919749 CAAGCGGCCACAAGGATGGCAGG + Exonic
1165435092 19:35790987-35791009 CAAGGGGCAGCAGGCAGGGCAGG + Intergenic
1165955307 19:39498855-39498877 CAAGGGACCAAGGGCGGGGCGGG - Intergenic
1166041250 19:40204404-40204426 CATGGGACCAAGGGCAGGGCTGG + Intronic
1166822313 19:45587994-45588016 CATGGGAACACAAGCAGAGATGG + Intronic
1166835980 19:45668270-45668292 CAAGTGACCAGGAGCAGGACTGG + Exonic
1166986398 19:46662164-46662186 CCAGGCTCCGCAAGCAGGGCTGG + Intergenic
1167188357 19:47964425-47964447 CAAGGGACAACAACCAGGCTGGG - Intergenic
1167597340 19:50434764-50434786 CAAGGAACAGCAGGCAGGGCAGG + Intronic
1167618846 19:50550362-50550384 CAAGAGACCAGGAGGAGGGCAGG + Intronic
925027530 2:621380-621402 CAAGGGACCAGACCCAGCGCCGG + Intergenic
925083959 2:1093191-1093213 CAAGGACCCACAAGCAGGTGCGG - Intronic
925187701 2:1860470-1860492 AAAGGGACCTCACTCAGGGCTGG + Intronic
928317025 2:30254645-30254667 AAAGGCATGACAAGCAGGGCAGG - Intronic
930512389 2:52360717-52360739 CAAGAGACTACAAGCTAGGCCGG - Intergenic
931757693 2:65388657-65388679 CAAAGGACCAAAAGCAGGAGGGG + Intronic
933498707 2:83085079-83085101 AAAGGGATCAGAAGCATGGCTGG + Intergenic
933893048 2:86788900-86788922 CATGGGACCCAAAGCAGGGTGGG + Intronic
934120980 2:88839282-88839304 CAAGGTACCCCATGCAGAGCAGG + Intergenic
935102554 2:100010787-100010809 CAAATGTCCACAAGCAGGGCAGG - Intronic
936523850 2:113229609-113229631 CAAGGGAACAAATGAAGGGCTGG + Intronic
938084433 2:128389535-128389557 CACGGGAGCACAGGCAGAGCAGG - Intergenic
938120495 2:128629532-128629554 CAGGGGGCCACTGGCAGGGCAGG + Intergenic
938637969 2:133249790-133249812 CAAGGGAACACAAGGTGGGGCGG + Intronic
939515427 2:143161561-143161583 CAAGGGACCACAAGGTTGGTGGG + Intronic
941063814 2:160878353-160878375 GGAAGGACCACAAGCAGGGCAGG - Intergenic
942678205 2:178450764-178450786 CCAGGGACCACGAGAGGGGCGGG + Intronic
946415795 2:219539073-219539095 CCAGGGCCCAGAGGCAGGGCTGG + Exonic
947198802 2:227596360-227596382 TAAGGGAGCAAATGCAGGGCAGG - Intergenic
948420473 2:237857123-237857145 CAGTGGACCACAAGAAGTGCAGG - Intergenic
948888611 2:240896334-240896356 CCAGGGACCCCAAGCCTGGCTGG - Intronic
1168807564 20:681421-681443 AAAGGGAGCAGAAGCAGGGCTGG - Intergenic
1169213890 20:3783005-3783027 TAAGGGGCCATAACCAGGGCAGG + Intergenic
1170257072 20:14356820-14356842 CAAGAGACCTCACGCACGGCTGG + Intronic
1170629268 20:18054411-18054433 CCCAGGACCACAAGAAGGGCAGG - Intronic
1171188179 20:23138340-23138362 CAAAGGACCACCAGGATGGCTGG - Intergenic
1172221320 20:33276932-33276954 GAATGGAGCACAAGCAGGGCTGG - Intronic
1173461260 20:43245104-43245126 GAATGGCCCACAAGCGGGGCTGG + Intergenic
1173591049 20:44225143-44225165 CAAGGGCCCACAAGAAGTGGTGG - Intergenic
1173991711 20:47308735-47308757 CCACGGAGCAAAAGCAGGGCTGG + Intronic
1174803106 20:53581624-53581646 CCAGGGTCCACAAGAAGGACCGG - Exonic
1175997505 20:62818157-62818179 CATGTGACCACCACCAGGGCAGG + Intronic
1177120606 21:17132853-17132875 CAGGGGAACACAAGCTGGGGAGG + Intergenic
1179362388 21:40723758-40723780 CAAGGGACCACAAGGATGAGTGG + Intronic
1179713050 21:43274042-43274064 CAAAACACCACATGCAGGGCAGG - Intergenic
1181390467 22:22576814-22576836 CCAGGGACCAAAGGCAGAGCTGG - Intergenic
1182304160 22:29356380-29356402 CCAGGGTCCTCAAGCTGGGCTGG + Intronic
1182347125 22:29674205-29674227 TAAGGGGCCTGAAGCAGGGCAGG - Intronic
1182466699 22:30521302-30521324 CAAGAGACCAGGGGCAGGGCTGG + Intergenic
1182687508 22:32132531-32132553 CAAGGGTCCTCAGGCTGGGCTGG - Intergenic
1183519184 22:38286618-38286640 CCTGGGACCACGAGCATGGCAGG - Intergenic
1184685205 22:46093668-46093690 AAAGGAACCCCAAGCAGGCCGGG - Intronic
1184974011 22:48047961-48047983 GAAGAGTCCACCAGCAGGGCAGG - Intergenic
1184997469 22:48219197-48219219 CAGGGGAGCACTAGCAGGTCAGG + Intergenic
952846314 3:37690691-37690713 GAAGGGAGAACAAGCAGGGCAGG + Intronic
953044183 3:39280784-39280806 CCAGGGAGCAGAAGCATGGCTGG - Intronic
953198001 3:40752122-40752144 CAAGGCACCTGAAGCAAGGCAGG + Intergenic
953741387 3:45541993-45542015 TTAGGGGCCACCAGCAGGGCAGG - Intronic
953956662 3:47236723-47236745 CAGGAGACCACAGGCAGGGCTGG + Intronic
954541954 3:51399236-51399258 CAAGAGACCACTAGAAAGGCAGG + Intronic
955370525 3:58347388-58347410 CCAGGGACCAGAAGGAGGGCAGG - Intronic
959837088 3:110932004-110932026 CAAGGTACCACATGTAGTGCGGG + Intergenic
960107969 3:113818321-113818343 GAAGGGAGCAAAAGCAGGGTTGG + Intergenic
960155946 3:114297434-114297456 CCTGGGACAATAAGCAGGGCAGG + Intronic
961785607 3:129344881-129344903 GAAGGGACCACGGGTAGGGCTGG - Intergenic
964065420 3:152572189-152572211 ACAGTGACCACAAGGAGGGCAGG + Intergenic
965841193 3:172907517-172907539 CAAGGAACAGCAAGCAGGGTAGG - Intronic
967215110 3:187203162-187203184 AAAGGGAGCACAAGAATGGCAGG - Intergenic
968564053 4:1300336-1300358 AAAGGGACACCAAGAAGGGCTGG + Intronic
970616706 4:17774448-17774470 CACGGGCCCAGAGGCAGGGCAGG + Intronic
975573323 4:75839409-75839431 CAAGGGACCAAAAGCAAGAAAGG - Intergenic
976459330 4:85290105-85290127 CTAGGGACCACTAGGAAGGCAGG + Intergenic
980158926 4:129136978-129137000 CAAGAGACCTCAAACAGGGTCGG - Intergenic
980885557 4:138758743-138758765 CAAAGGCCCAGAATCAGGGCAGG + Intergenic
982638980 4:157933081-157933103 CAAGGAACAACAGGCAGTGCAGG - Intergenic
984636907 4:182120789-182120811 CAAGGGACAGCAAGCAGACCAGG + Intergenic
985686909 5:1286368-1286390 CAAAGGAGGAAAAGCAGGGCGGG + Intronic
986129231 5:4911691-4911713 CAAGGGAACAGAATCAGGACAGG - Intergenic
986304638 5:6506275-6506297 CAGGCGACCCCAAGCAGGACGGG - Intergenic
987093681 5:14529641-14529663 CCAGGGACCACATTCTGGGCAGG - Intronic
987881993 5:23760026-23760048 CCATGGACCACAAGCAGTCCAGG + Intergenic
990349407 5:54900714-54900736 CATGGGAACAAAAGCAGGACTGG - Intergenic
996111520 5:119571520-119571542 CAAGGGGCCACAAGTCTGGCAGG + Intronic
996115062 5:119609061-119609083 CATGAGGCCAGAAGCAGGGCGGG - Intronic
996180917 5:120419391-120419413 GAAGAGACCACATGCAGGGTGGG + Intergenic
999089910 5:148926961-148926983 CCAGGGACCACAACCTGGCCTGG - Intronic
999330934 5:150672826-150672848 CAAGGAAGCACCGGCAGGGCCGG + Intronic
999693324 5:154167418-154167440 AAGGTGTCCACAAGCAGGGCAGG + Intronic
1002800390 6:516525-516547 CAAGGGATCAAAAGAAAGGCAGG + Intronic
1002927060 6:1610789-1610811 ACCGGGACAACAAGCAGGGCTGG + Exonic
1007263425 6:40579710-40579732 CTGGGGTCCACAAACAGGGCTGG + Intronic
1007861692 6:44916475-44916497 CAAGGGCAAACATGCAGGGCAGG + Intronic
1007946818 6:45834412-45834434 CTTGGGGCCACAAGCAGGGATGG - Intergenic
1013487748 6:110614305-110614327 CAATGGAACACATGCAGGGAAGG + Exonic
1017569169 6:155724781-155724803 TATGGGACCACAGGCAGTGCAGG + Intergenic
1017942102 6:159061938-159061960 CAAGGGACCACAGACTGGGTGGG - Intergenic
1017983046 6:159419514-159419536 CAAGGGATGACAAGCATGACAGG + Intergenic
1018100797 6:160437971-160437993 CACAGGACCACCTGCAGGGCTGG - Intronic
1018671313 6:166179839-166179861 CAAAGGAACACAGGCGGGGCCGG + Intergenic
1018706159 6:166464578-166464600 CAAGGGACGCCAGGCTGGGCTGG + Intronic
1019079010 6:169415229-169415251 CAAACGATCTCAAGCAGGGCAGG + Intergenic
1020103889 7:5411886-5411908 CAAGGGACCAGAAGGCTGGCTGG + Intronic
1022109396 7:27219387-27219409 GGAGGGGCCACCAGCAGGGCCGG - Intergenic
1022522540 7:31017416-31017438 CAAGGAACCAGAAGCAGAGTGGG - Intergenic
1022569147 7:31434344-31434366 CAATGGCCTACAAGCAGGACAGG + Intergenic
1023570827 7:41569701-41569723 CCAGGGTCCCCAAGCAGGTCTGG + Intergenic
1025777780 7:64574335-64574357 CAAAGGACCAGAAGCCGGGAAGG + Intergenic
1034968437 7:155405137-155405159 CACAAGACCACAAGCAGGCCTGG - Intergenic
1039329690 8:36523568-36523590 CAAGGCAGCACATGCAAGGCAGG + Intergenic
1039673540 8:39633100-39633122 CAAGGCTCCACAAACAGGTCTGG - Intronic
1040033864 8:42850149-42850171 CAAAGGACAGCAAGGAGGGCTGG + Intronic
1048497639 8:134948316-134948338 CAAGGGAACACAACCAGGGAGGG - Intergenic
1048558357 8:135505365-135505387 CAAGGGACCACAAGCAGGGCAGG - Intronic
1049275542 8:141718365-141718387 GAAGGCACTACAGGCAGGGCAGG - Intergenic
1052213469 9:25935822-25935844 CATGGAACCACAACCAGTGCAGG + Intergenic
1053283780 9:36837918-36837940 CCTGGAACCACAAGGAGGGCAGG + Exonic
1054835538 9:69672134-69672156 CAAGGTACCACAGCCAGGGAGGG - Exonic
1056501447 9:87213808-87213830 TAAGGGCCCAGCAGCAGGGCTGG + Intergenic
1057086175 9:92212894-92212916 CAAGGGAACAAAATCAAGGCAGG + Intronic
1057581900 9:96294541-96294563 CAAGGGACCACAGGAAGGTCAGG + Intronic
1060219875 9:121758843-121758865 GAAGGGACCACAGCAAGGGCAGG - Intronic
1061169229 9:128942443-128942465 CAAGCCACGCCAAGCAGGGCTGG - Intronic
1061498410 9:130989011-130989033 TGAGGGACCACAGGAAGGGCAGG - Intergenic
1061947266 9:133915268-133915290 CACGTGATCACAAGGAGGGCGGG - Intronic
1187825670 X:23332666-23332688 CTAGGGAGCACAAGCAGAGCAGG + Intergenic
1190752580 X:53375128-53375150 GAAGGGACTGCAAGCATGGCAGG + Exonic
1190888467 X:54549396-54549418 CATAGAACCACAAGGAGGGCTGG + Intronic
1195077361 X:101339786-101339808 CTAAGGACCTCTAGCAGGGCTGG - Intergenic
1198242079 X:134796787-134796809 CTGAGGACCACAAGCGGGGCCGG + Intronic
1200135659 X:153873393-153873415 CAAGGGGGCACACGCTGGGCTGG + Intronic
1200697859 Y:6376888-6376910 CCAGGGCCCACAATCAGGCCTGG + Intergenic
1201036253 Y:9787811-9787833 CCAGGGCCCACAATCAGGCCTGG - Intergenic