ID: 1048558360

View in Genome Browser
Species Human (GRCh38)
Location 8:135505369-135505391
Sequence GTCCCAAGGGACCACAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558360_1048558369 15 Left 1048558360 8:135505369-135505391 CCCTGCTTGTGGTCCCTTGGGAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558360_1048558364 -2 Left 1048558360 8:135505369-135505391 CCCTGCTTGTGGTCCCTTGGGAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1048558364 8:135505390-135505412 ACCCTTGAGAGCTCTCCTTCAGG No data
1048558360_1048558366 -1 Left 1048558360 8:135505369-135505391 CCCTGCTTGTGGTCCCTTGGGAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558360 Original CRISPR GTCCCAAGGGACCACAAGCA GGG (reversed) Intronic
900290044 1:1919916-1919938 GACCCGAGGGACCACACCCAAGG - Intergenic
900295515 1:1947184-1947206 GCCCCAAGGGGCCACACGGATGG - Intronic
901217451 1:7562792-7562814 GTCCCCAGGACCCCCAAGCAAGG + Intronic
901680648 1:10910767-10910789 GTGCCAAGGGACACCAAGCAGGG + Intergenic
902511201 1:16967878-16967900 GTCCCAGGGTACCACAACCTGGG - Intronic
903063153 1:20684194-20684216 GCCCCAAGGGCCCACAGGCCAGG - Intronic
905237525 1:36560413-36560435 GTCCCACGGGAGCAAAGGCACGG + Intergenic
906093152 1:43199943-43199965 GTCACAAGGGCCCAAATGCATGG + Intronic
909751970 1:79172615-79172637 GTGCCAAAGGAACAAAAGCAGGG - Intergenic
910400453 1:86832808-86832830 GTCCCACTGGGCTACAAGCAAGG - Intergenic
912544676 1:110442098-110442120 GACCCAGGGGACCAGAAGCAAGG - Intergenic
913524504 1:119678202-119678224 TTCCCAAGGGAGCATAAACAGGG - Intronic
913547638 1:119885369-119885391 TTCCCAAGGGCACACAGGCATGG - Intergenic
915095505 1:153459629-153459651 TTCCCAAGGGAATACAAGAAGGG - Intronic
919572430 1:199265581-199265603 GCCCCACGGGTACACAAGCAGGG + Intergenic
1063283285 10:4655100-4655122 GTCCCTAGGGAGCCCAAGGAGGG + Intergenic
1063610376 10:7557121-7557143 GCCCCAAGGGAGTGCAAGCAAGG + Intergenic
1064169366 10:13016669-13016691 GAGCCAGGGGACCACAGGCAGGG - Intronic
1067704079 10:48594271-48594293 CTCCCATGGGACCACCATCAGGG + Intronic
1068235469 10:54227439-54227461 GTCCCAAGGCTGCACAAGCATGG + Intronic
1069389235 10:67915019-67915041 TTCCCAAGACACCACAGGCAGGG - Intronic
1072016565 10:91352917-91352939 GGCCCAAGGGATGACAAGCGTGG + Intergenic
1075905679 10:126079822-126079844 GTGCCAATGGACAACAGGCAAGG + Intronic
1076544401 10:131235084-131235106 GGCCCAGGGTACCACAGGCAGGG + Intronic
1076775119 10:132691138-132691160 CTCCCGAGGGAGCACAAACACGG - Intronic
1078494090 11:11798749-11798771 CTCCCCAGGGACAAAAAGCAAGG - Intergenic
1079311226 11:19367690-19367712 GTCCTTAGGGCCCACAAGGATGG - Intronic
1083732115 11:64658043-64658065 GTCCCAAGGGCCCACAGGATAGG + Intronic
1084586627 11:70066311-70066333 TTCCCAAGGGACCCCATGCTTGG + Intergenic
1085184332 11:74562544-74562566 TTCCCAGAGGTCCACAAGCAAGG - Intronic
1085691516 11:78667981-78668003 GTCCCAGGGTCCCACAGGCAGGG - Intronic
1085771241 11:79327994-79328016 GACCCAAGGGTACATAAGCATGG + Intronic
1089149147 11:116351338-116351360 GCCCCCAGGGACCACAAGGATGG + Intergenic
1089707152 11:120286938-120286960 GCCACAGTGGACCACAAGCAGGG + Intronic
1090473346 11:126999289-126999311 GTCTGCAGTGACCACAAGCACGG + Intronic
1090661873 11:128888276-128888298 GTGCTCAGGGACCACAAGAAAGG - Intergenic
1096880151 12:54660745-54660767 CTACCAAGGGACAACAGGCAGGG - Intergenic
1097287688 12:57890150-57890172 TTCCCAAGGGACCAGAGCCAGGG + Intergenic
1097810534 12:64013948-64013970 GTCAAAAGAGACCACAAGAAAGG + Intronic
1103913193 12:124363163-124363185 GTCCCAAGGGACCACCAGCCTGG + Intronic
1117659387 14:57987914-57987936 GTCCCCAGGGACTAATAGCAGGG - Intergenic
1118924239 14:70177453-70177475 GTGCCAAGAGATCACAAGAAAGG + Intronic
1119023335 14:71133513-71133535 GTCTTAAAGGACCACCAGCACGG + Intergenic
1119087757 14:71753099-71753121 CTCCCAAGGGATCAGAAACAGGG - Intergenic
1128713994 15:69893709-69893731 GTCCCCATGGAACCCAAGCAGGG + Intergenic
1129191833 15:73941964-73941986 GGAACAAGGGACCACAAGGACGG + Intronic
1129674471 15:77624977-77624999 GTCCCAAGGGGCCACTGGCCTGG - Intronic
1130555290 15:84918343-84918365 GTCCCAGGGTTCCACATGCAGGG - Intronic
1130730439 15:86486780-86486802 GACCCAAGTGTCCATAAGCAGGG - Intronic
1132483383 16:177428-177450 GGCCCAAGGGGCAAGAAGCATGG - Exonic
1144411423 17:15005683-15005705 GTCCCAAGGAAGCACACGCTGGG - Intergenic
1144929656 17:18848925-18848947 GTCCACAGGGACTGCAAGCAGGG + Intronic
1147405556 17:40209318-40209340 GAACAAAGGGACCACAAGGATGG + Intergenic
1148557211 17:48585685-48585707 ATCCCAAGGGATCCCAAGGAGGG - Intronic
1151984177 17:77531478-77531500 CTCCCTAGTGACCACAAGGATGG - Intergenic
1158267581 18:55677261-55677283 GTCCCCAGGGACCCAGAGCAGGG - Intergenic
1161301229 19:3544070-3544092 GTCCCAGGGGACCAGAGGCTCGG + Intronic
1162326574 19:10003137-10003159 GTCCCCAGTGACCCCAAGCAGGG + Intronic
1162786609 19:13038946-13038968 GGCCCAAGGGTCTACATGCAAGG + Intronic
1166069503 19:40378838-40378860 ATCCCAAGGGTGAACAAGCATGG + Intronic
926897479 2:17710110-17710132 GTGCCAAGTAACCAGAAGCAGGG + Intronic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
932146074 2:69318499-69318521 GTCCTAGGGGATTACAAGCATGG + Intergenic
935621493 2:105134304-105134326 CTCCCAAGAGACCAGAATCAAGG + Intergenic
936144779 2:109973335-109973357 GACCCAAGAGAACATAAGCAGGG - Intergenic
936181465 2:110271298-110271320 GACCCAAGAGAACATAAGCAGGG - Intergenic
936199907 2:110398134-110398156 GACCCAAGAGAACATAAGCAGGG + Intergenic
938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG + Intergenic
941494924 2:166188065-166188087 GTCCCAAGGAGACAGAAGCAGGG + Intergenic
942286663 2:174424310-174424332 GTCCCCAGGGAAGACAGGCATGG + Intronic
944613108 2:201431357-201431379 GTGTCAATGGACCAAAAGCAAGG + Intronic
947145391 2:227059483-227059505 GTCCCAGGTGACCAAATGCAGGG + Exonic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
949032163 2:241802371-241802393 GACCCAAGGGACCCAAAGAAGGG - Intronic
1168999620 20:2158753-2158775 GTCACCAGAGACCATAAGCATGG + Intronic
1169149241 20:3276313-3276335 GTCCCATGGGCCCAGAAGCAAGG + Intronic
1174035076 20:47663824-47663846 CTCCCAAGGGGGCACAAGCTGGG + Intronic
1175384984 20:58589032-58589054 TTCCCAAGGGCCCATAAACAGGG - Intergenic
1179629254 21:42666517-42666539 GTCACAAAGGACCACAGGCCCGG + Intronic
1180127581 21:45802730-45802752 GTCCCCAAGGACCCCAGGCAGGG + Intronic
1180875574 22:19173722-19173744 GTCCCTTGGGGCCACGAGCATGG - Intergenic
1185372615 22:50468038-50468060 GTCCCCAGGGTCTCCAAGCAAGG - Intronic
950242720 3:11386126-11386148 CTGCCAAGTGACCACAAGCAAGG + Intronic
950707025 3:14789181-14789203 GACCAAAGGGACCACAAGGAGGG - Intergenic
953069972 3:39509842-39509864 TTCCCCAGGGACCCCCAGCAGGG + Intronic
953494199 3:43372360-43372382 GTCTCAAGGCAGCCCAAGCAGGG + Intronic
955370528 3:58347392-58347414 GTTCCCAGGGACCAGAAGGAGGG - Intronic
968004012 3:195226960-195226982 CTCTCCAGGGTCCACAAGCAGGG + Intronic
969595588 4:8147808-8147830 GTCACCAGTGACCACAAGCTGGG - Intronic
975655930 4:76641325-76641347 GTCCCAAGGGAGGATGAGCAGGG - Intronic
985903294 5:2813783-2813805 GTACAGAGGGACCCCAAGCAGGG - Intergenic
986178188 5:5369659-5369681 GGCTGAAGGGAGCACAAGCATGG + Intergenic
990161409 5:52944084-52944106 GCCCCAGGTGACCACAAGCCAGG - Intronic
992524153 5:77590421-77590443 GCCCCAAGGGACCACACAGATGG + Intronic
994082145 5:95718868-95718890 GTCCCAGGAGAGCACAAGCAGGG + Intronic
994303460 5:98174575-98174597 GTACTAAGGGACCATAGGCAGGG + Intergenic
994901167 5:105771470-105771492 GGAGCAAGGGACCACAAGTAGGG - Intergenic
1004066987 6:12256583-12256605 TTCCCAAGAGGCCAAAAGCATGG + Intergenic
1013487747 6:110614301-110614323 GTCACAATGGAACACATGCAGGG + Exonic
1014066929 6:117137825-117137847 GTCCCAAGGCATCAGAACCAAGG + Intergenic
1017043667 6:150327571-150327593 GTGCCAAAGGACCACAAACTAGG + Intergenic
1017916771 6:158837188-158837210 GTCACAAGGGACCGCAAACTTGG + Intergenic
1018266209 6:162027373-162027395 GCCCAGAGGGACCACAAACATGG - Intronic
1021408609 7:20303061-20303083 GACCCAAGGGTCCAAAAGCTTGG + Intergenic
1022023456 7:26423566-26423588 GTCTCAAGGCACCAGAAGCCAGG - Intergenic
1025602383 7:63012827-63012849 GTCCCAAGGTTCCAGAGGCAAGG + Intergenic
1026475169 7:70728976-70728998 CTCCCAAGGGGCCACATGAAAGG + Intronic
1027219621 7:76205609-76205631 GCCCCCAAGGACCACAGGCATGG - Intronic
1029440989 7:100586467-100586489 GGGCCGAGGGACCGCAAGCAGGG + Intronic
1029931532 7:104376415-104376437 ATGCCAAGAGACCACAAGAAAGG + Intronic
1032853414 7:135814339-135814361 GTCCCACTGGACTAAAAGCAAGG - Intergenic
1033863251 7:145656112-145656134 GTCCCAAAGGAACAGAGGCAGGG - Intergenic
1035873626 8:3163460-3163482 GTGCCTGGGGACCACTAGCATGG - Intronic
1036032987 8:4992825-4992847 GTCCCGAGCGACCACGAGCTTGG + Intronic
1036604843 8:10295691-10295713 GTGCCAAGTGACCACAGGCTGGG - Intronic
1043270710 8:78329732-78329754 GGTCCCAGGGACCACAAGGAGGG - Intergenic
1044270536 8:90237733-90237755 GTCCCACGGGATGACAAGGAGGG + Intergenic
1047315323 8:123727703-123727725 GTGCCAAGGGTCCACAACCCTGG + Intronic
1047684586 8:127291934-127291956 GTTCCAAGGAACATCAAGCAAGG - Intergenic
1048319801 8:133389590-133389612 GACCCAAGGTCCCACAGGCAGGG + Intergenic
1048558360 8:135505369-135505391 GTCCCAAGGGACCACAAGCAGGG - Intronic
1048729218 8:137418977-137418999 GTCCCAAGGCTGCACATGCAGGG + Intergenic
1053214726 9:36260950-36260972 GTTTCAAGGGACCAAAATCAAGG + Intronic
1055441003 9:76336172-76336194 GTCTCAAGTTACCACAAGCTGGG + Intronic
1056725096 9:89107333-89107355 GTCCTCAGGGACCACAACCCAGG - Intronic
1061877115 9:133549738-133549760 GTGCCAAGAGACCAGCAGCATGG - Intronic
1062375591 9:136260469-136260491 GTCTCAAGGGGCCACATGCTGGG - Intergenic
1185854340 X:3520269-3520291 TTTCCAAGGGAGCACAACCATGG - Intergenic
1187169651 X:16838812-16838834 GTCCCAGAGGACCAGAAGGATGG - Intronic
1187808243 X:23144851-23144873 GTCCAAAGGCCTCACAAGCAGGG - Intergenic
1190259902 X:48791119-48791141 GTCCCCAGGGACCCCAGGCCAGG - Exonic
1193707903 X:84845066-84845088 GTCCCTAGGCTGCACAAGCAGGG + Intergenic
1193711314 X:84883860-84883882 GTCCCTAGGCTGCACAAGCAGGG - Intergenic
1196862271 X:120039544-120039566 GACCCAAGAGACCACCAGGAGGG + Intergenic
1196880831 X:120196800-120196822 GACCCAAGAGACCACCAGGAGGG - Intergenic