ID: 1048558361

View in Genome Browser
Species Human (GRCh38)
Location 8:135505370-135505392
Sequence GGTCCCAAGGGACCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558361_1048558369 14 Left 1048558361 8:135505370-135505392 CCTGCTTGTGGTCCCTTGGGACC 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558361_1048558364 -3 Left 1048558361 8:135505370-135505392 CCTGCTTGTGGTCCCTTGGGACC 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1048558364 8:135505390-135505412 ACCCTTGAGAGCTCTCCTTCAGG No data
1048558361_1048558366 -2 Left 1048558361 8:135505370-135505392 CCTGCTTGTGGTCCCTTGGGACC 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558361 Original CRISPR GGTCCCAAGGGACCACAAGC AGG (reversed) Intronic
900966058 1:5959411-5959433 GGGCCAAGGGGACCACAAGATGG - Intronic
901680647 1:10910766-10910788 GGTGCCAAGGGACACCAAGCAGG + Intergenic
901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG + Intergenic
902511202 1:16967879-16967901 GGTCCCAGGGTACCACAACCTGG - Intronic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
904402280 1:30264580-30264602 GGTGCCAAGGGCCTACAAGGGGG + Intergenic
906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG + Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
909751971 1:79172616-79172638 GGTGCCAAAGGAACAAAAGCAGG - Intergenic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
914196717 1:145451607-145451629 TGTCCCACGGGGCCACATGCTGG - Intergenic
915095506 1:153459630-153459652 GTTCCCAAGGGAATACAAGAAGG - Intronic
916236343 1:162592593-162592615 CGTCCCAAGAGACCAAAAGGGGG - Intronic
919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG + Intergenic
923055593 1:230424535-230424557 AGGCCCAAGGGACCTCCAGCTGG - Intronic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG + Intergenic
1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG + Intronic
1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG + Intergenic
1078068410 11:8093020-8093042 GGTCCCAAGTGAGCACAAATGGG + Intronic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG + Intronic
1096880152 12:54660746-54660768 GCTACCAAGGGACAACAGGCAGG - Intergenic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1102742365 12:115219301-115219323 GATCCTAAGGGACCACAGTCTGG + Intergenic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1117337381 14:54766906-54766928 GGTACCAAGGGAGGACATGCAGG - Intronic
1119671639 14:76524333-76524355 GGTCCCAAGGAACAACATGGAGG - Intergenic
1123139571 14:106062077-106062099 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1123187895 14:106537738-106537760 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1126430297 15:48576473-48576495 GATCCCAACAGACCATAAGCTGG + Intronic
1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG + Intergenic
1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG + Intronic
1131953473 15:97706281-97706303 GGTCCCAAAGGATCACATGGTGG + Intergenic
1133941949 16:10316760-10316782 GGTCCCATGGGAAGCCAAGCTGG + Intergenic
1141740271 16:85887066-85887088 CGTCCCCAGAGACCACAAGTTGG - Intergenic
1143121060 17:4607227-4607249 GTTCCCAAGGACCCACCAGCGGG - Intronic
1144411424 17:15005684-15005706 TGTCCCAAGGAAGCACACGCTGG - Intergenic
1148767196 17:50046309-50046331 AGCCCAAAGGGACCACAAGGTGG - Intergenic
1150993501 17:70288493-70288515 TGGACCAAGGGACCACAAGATGG + Intergenic
1151474914 17:74339845-74339867 GGTCCAAAGGGACCTCAGGCAGG + Intronic
1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG + Intronic
1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG + Intergenic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
927640377 2:24841880-24841902 GGTCCCCAGGCACCACAGGGAGG - Intronic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
943767343 2:191677630-191677652 GGTACCAAGGGAAAACAGGCTGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
947630854 2:231652178-231652200 GGTCCGAAGGGGCCTCAACCTGG + Intergenic
947982917 2:234425576-234425598 GGTCTGAAGGGACCACCAGCAGG - Intergenic
1169305326 20:4484866-4484888 GCTCCCCAGGGACCATAGGCGGG - Intergenic
1173086763 20:39927206-39927228 AGTCCCAAAGGATCACAAGGTGG + Intergenic
1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG + Intronic
1175165537 20:57041303-57041325 GTCCCCAAGGGGCCAGAAGCGGG - Intergenic
1176026963 20:62990704-62990726 GGTACTAAGTGCCCACAAGCCGG - Intergenic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
950707026 3:14789182-14789204 AGACCAAAGGGACCACAAGGAGG - Intergenic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
966759907 3:183408468-183408490 GGTCCCTAGGGGCCAGAACCAGG - Intronic
968450954 4:675698-675720 GTTCCTAACGGGCCACAAGCTGG - Intronic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
979089280 4:116459527-116459549 GGTCTCAAGGGAGCACACCCTGG + Intergenic
983495558 4:168438662-168438684 TGTCACAAAGCACCACAAGCTGG - Intronic
985421905 4:189792953-189792975 GGACGCAAGAGACTACAAGCTGG + Intergenic
985903295 5:2813784-2813806 GGTACAGAGGGACCCCAAGCAGG - Intergenic
988210069 5:28192588-28192610 GTTCCCATGGGATCTCAAGCTGG - Intergenic
992071240 5:73151235-73151257 GGTCCCCAGGGCCCACAAAGCGG - Intergenic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
994816394 5:104592678-104592700 GGTCCCCAAAGACCACAAGTTGG - Intergenic
994901168 5:105771471-105771493 GGGAGCAAGGGACCACAAGTAGG - Intergenic
1001944948 5:175770983-175771005 GGTCTCAAGGGACCAGAAGAAGG - Intergenic
1004974147 6:20946254-20946276 GTTCCCAAGGAACCACAAAGAGG - Intronic
1015827162 6:137326362-137326384 TCTCCCATGGAACCACAAGCTGG - Intergenic
1019135010 6:169902511-169902533 GGTCCCAAGGCACCAAGACCGGG + Intergenic
1019927993 7:4205928-4205950 GGTCCCACGTGACCTCCAGCTGG - Exonic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1026759269 7:73114245-73114267 GGACCCAAGTGTCCACCAGCAGG - Intergenic
1027088139 7:75279228-75279250 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029394247 7:100296386-100296408 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1032392333 7:131563609-131563631 GGTCCCAAGGGCCCACGTTCAGG - Intergenic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1040351492 8:46573091-46573113 GCTCCCAAATGACCACAAGGTGG - Intergenic
1040365179 8:46708347-46708369 GCTCCCAAATGACCACAAGGTGG + Intergenic
1043270711 8:78329733-78329755 GGGTCCCAGGGACCACAAGGAGG - Intergenic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1047542843 8:125787111-125787133 GGTCCCAAGAAAGCAAAAGCAGG - Intergenic
1047559539 8:125971799-125971821 AGTACCAAAGGACCAAAAGCTGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1053426516 9:38013807-38013829 GGTCCCATGGAGCCACAGGCAGG - Intronic
1055441002 9:76336171-76336193 AGTCTCAAGTTACCACAAGCTGG + Intronic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1060402007 9:123354806-123354828 GGTCCCCAGGGACCAAAGGAGGG - Intergenic
1062375592 9:136260470-136260492 AGTCTCAAGGGGCCACATGCTGG - Intergenic
1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG + Intronic
1195919994 X:109974220-109974242 GGACCCAAGGAACCACAAAGTGG - Intergenic
1200110180 X:153736984-153737006 GGTCCCTAGGGAACACAGCCAGG - Intronic