ID: 1048558362

View in Genome Browser
Species Human (GRCh38)
Location 8:135505382-135505404
Sequence AGAGCTCTCAAGGGTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558362_1048558369 2 Left 1048558362 8:135505382-135505404 CCCTTGGGACCCTTGAGAGCTCT 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558362 Original CRISPR AGAGCTCTCAAGGGTCCCAA GGG (reversed) Intronic
900621955 1:3591647-3591669 AGAGCTCACAAGGGACCTGATGG + Intronic
902761502 1:18583788-18583810 AGGGCTCCCAAGGCTCCCAGAGG - Intergenic
905801830 1:40849214-40849236 AGAGCTGCCAAGGCTCCCAAGGG + Intergenic
905934178 1:41810632-41810654 AGAGCTCCAAGGGGTTCCAAAGG - Intronic
906823188 1:48950542-48950564 AGAGCTCTACAGAGTGCCAATGG + Intronic
907300951 1:53485948-53485970 AGAGCACTCACGGGGCCCCACGG - Intergenic
907511227 1:54962090-54962112 AGAAATCTCAAGGGTTCCAATGG - Intergenic
911578980 1:99613229-99613251 AGAGCTCTGAAGAGTCCAAGGGG - Intergenic
911864246 1:102995871-102995893 AGAGGTCTCAAGGGATCTAAAGG - Exonic
912738518 1:112172150-112172172 ACAGCTCTAAAGTGTCACAAAGG + Intergenic
913146286 1:115993315-115993337 AGAGCTGGCAAGGGTCCCAGAGG - Intronic
917514391 1:175695228-175695250 AGGACTCTCAAGGGGCCCAGTGG + Intronic
920333642 1:205229486-205229508 AAAGCGCTCAAAGATCCCAATGG - Intronic
921334570 1:214073485-214073507 AGAGATCTCAAGAGACCAAAAGG + Intergenic
923670829 1:236039864-236039886 AGAGCTCTCAGGGGTCATTATGG + Intronic
1063239557 10:4153820-4153842 AAAGCTCTTTTGGGTCCCAAAGG + Intergenic
1067769587 10:49113927-49113949 CCAGCTCTCAAGGCTCCCGAGGG + Intronic
1073028484 10:100506126-100506148 AGAACACTGAAGGGTCCCGAGGG + Exonic
1073272272 10:102275418-102275440 TGAGGTCTCAATGCTCCCAAAGG - Intronic
1074905908 10:117863470-117863492 ACTGCTCTCAAGGGTCCCGTGGG - Intergenic
1077406623 11:2385312-2385334 AGAGATCCCAAGGGCCCCAGGGG - Intronic
1078539124 11:12199438-12199460 ACAGCTCTCAAGGAACACAAGGG + Intronic
1078753216 11:14184824-14184846 AGAGCTTTCAGGGATCCCAAAGG - Intronic
1084515713 11:69637154-69637176 AGCGCTTTCAAGCGTTCCAAGGG + Intergenic
1085280384 11:75326093-75326115 GGAGCTCTGCAGGGTCCCAGGGG + Intronic
1087597581 11:100273149-100273171 AGGCCTCTCAAGGCTCCCGAGGG - Intronic
1087704720 11:101477260-101477282 AGAGCTGAGAAGGGTCTCAAGGG - Intronic
1089311985 11:117564395-117564417 ACAGCTCTCAAGAGGCCAAAGGG + Intronic
1089920344 11:122203538-122203560 AGAGCTCTAGAGGGACCGAAAGG - Intergenic
1091355524 11:134934783-134934805 AGAGCTCACAGGGGGTCCAAGGG + Intergenic
1091355615 11:134935462-134935484 AGAGCTCACAAGGGTGTCCAAGG + Intergenic
1092172642 12:6383589-6383611 ACAGCTCTCAAGGGTCTCCTAGG + Intronic
1092925757 12:13270665-13270687 AGACCTTTCAAGTGTCCCCATGG - Intergenic
1094122255 12:26986795-26986817 ACAGCTCTCACTGGTACCAATGG + Intronic
1101696428 12:107131586-107131608 ACTGCTCTGAAGAGTCCCAAGGG - Intergenic
1102049821 12:109854739-109854761 GGAGCTCTCGAGGGGCCCATGGG + Intronic
1102755716 12:115338298-115338320 TGATTTCTCAAGAGTCCCAAGGG + Intergenic
1104202412 12:126602809-126602831 AGAGCTCTCAAGGGTGCTGTTGG + Intergenic
1108335208 13:49433864-49433886 AGAGCACTGAAGGGTCATAAAGG + Intronic
1113464346 13:110503442-110503464 AGAGGCCCCAAGGGACCCAAGGG + Exonic
1115092578 14:29596023-29596045 AGAGCTATCATGTGTGCCAAAGG - Intronic
1118385355 14:65251638-65251660 GGGGCTCTCCAGGGTCCCAGGGG - Intergenic
1119226453 14:72947889-72947911 ACAGCCCCCAAGGGTCCCAGAGG - Intronic
1131132814 15:89910951-89910973 GGATCTCCAAAGGGTCCCAAAGG + Intronic
1132605122 16:790421-790443 AGAGCCAACAAGGGTCCCCAGGG - Intronic
1133140382 16:3739498-3739520 AGGGCTCTTAAGTGTCCCAGAGG - Intronic
1133266635 16:4588612-4588634 AGGACTCTCAAGTGGCCCAAAGG - Intronic
1136555088 16:31002900-31002922 AGAGCTTGCCAGGGTCCCAGCGG + Intronic
1137021455 16:35432350-35432372 ATAGCTCTCCAGGGTCCCAGCGG + Intergenic
1138460641 16:57145799-57145821 AGGGCTCTCAGAGGCCCCAAGGG + Intronic
1140475310 16:75236958-75236980 ATGGCTGTCAAGGGTCCCAATGG - Exonic
1141270698 16:82538576-82538598 ACAGCTCTCTAGGGTCTGAAGGG + Intergenic
1141672078 16:85497415-85497437 AGAGCCCTCCAGGGGCCCACGGG + Intergenic
1143486007 17:7254653-7254675 ATGGCTCTCAAGGCTCCCAGCGG - Exonic
1144286828 17:13785313-13785335 AGTGGTCTCCAGGGTCCCAGTGG + Intergenic
1144384484 17:14736721-14736743 AGATCACTCAGGGATCCCAAAGG - Intergenic
1144595626 17:16568336-16568358 ACAGTGCTCAAGGTTCCCAAGGG + Intronic
1144841910 17:18191967-18191989 AGAGCTGTCAAAGGTCTCAAAGG - Intronic
1146794910 17:35774024-35774046 AGAGCTCTCCAGAGTCCCTGAGG - Intronic
1148127982 17:45246646-45246668 AGTTCTCCCAAGGGTCCCAGGGG - Intronic
1148677031 17:49451601-49451623 AGAGCCCCCAAGGGCCCCCAAGG + Intronic
1149263964 17:54907722-54907744 GGATATCTCAAGGGTGCCAAAGG + Intronic
1150716057 17:67573449-67573471 AGAGGTCTCCAGGGTGCAAATGG + Intronic
1153988821 18:10376934-10376956 AGAGCTGTCAGGGTTTCCAAGGG - Intergenic
1155613533 18:27695860-27695882 TGAGAATTCAAGGGTCCCAAAGG + Intergenic
1158020001 18:52830727-52830749 AGAGGTTTCTTGGGTCCCAACGG - Intronic
1159595660 18:70380549-70380571 AGAGCTCTTTAGGGTCCCTTTGG + Intergenic
1163419603 19:17206631-17206653 TCAGCTCCCAAGGGTCCCCAAGG - Intronic
1165147849 19:33743248-33743270 AGAGATCAAAAGGCTCCCAAAGG - Intronic
1165749243 19:38250376-38250398 AGAGGCCTGGAGGGTCCCAAGGG - Intronic
1166148189 19:40851307-40851329 AAAAATCTCAAGTGTCCCAAGGG + Intronic
1166152331 19:40883092-40883114 AAAAATCTCAAGTGTCCCAAGGG + Intronic
1166177846 19:41087568-41087590 AAAAATCTCAAGTGTCCCAAGGG - Intergenic
925284771 2:2708792-2708814 AGAGCTCCCGAGGCTCACAAAGG - Intergenic
927204782 2:20600268-20600290 ACAGCTCAATAGGGTCCCAAGGG + Intronic
929759148 2:44791708-44791730 AGAGATCTGAAGGGTACCAAGGG + Intergenic
934579691 2:95428041-95428063 AGTGCTCTAAAGGCTCCCCAAGG - Intergenic
934599755 2:95648684-95648706 AGTGCTCTAAAGGCTCCCCAAGG + Intergenic
935051980 2:99531818-99531840 AGACCTCCCCAGGGTCCCACTGG + Intergenic
935269918 2:101425319-101425341 ATGGATCTCAAGGGCCCCAAGGG - Intronic
935545924 2:104399435-104399457 AGAGCACTAAAAGGGCCCAAGGG + Intergenic
935899560 2:107776233-107776255 AGGGCTCTCAAGTGTGGCAAGGG - Intergenic
936506896 2:113115340-113115362 AGAGACCCCAAGGCTCCCAAAGG - Intronic
936533098 2:113290689-113290711 AGTGCTCTAAAGGCTCCCCAAGG + Intergenic
937232141 2:120404466-120404488 AGAGCCCCCAAGGCTCCAAAGGG + Intergenic
938229738 2:129648089-129648111 AGGGCTCTCAATCTTCCCAAAGG - Intergenic
941281417 2:163556310-163556332 ATAGCTTTCTAGGGTCACAAAGG + Intergenic
945006351 2:205411617-205411639 AGAGCATTCTAGGCTCCCAAAGG - Intronic
947145175 2:227057555-227057577 CTAGGTCTCAAAGGTCCCAAAGG - Exonic
947389123 2:229621749-229621771 TGAGCTCAGAAGGCTCCCAAGGG + Intronic
1169765397 20:9142866-9142888 AGCACTCACAAGGGCCCCAAGGG + Intronic
1170546570 20:17439903-17439925 ACAGCTGTCACGGGTCCCAGGGG + Intronic
1174538586 20:51271920-51271942 AGAGCTCTGGAGGAACCCAAGGG + Intergenic
1175998164 20:62820564-62820586 CGAGCTCCCAAGGGTCCCAAGGG - Intronic
1176515757 21:7782047-7782069 AGAACTCTCAAGGGTTCCCTAGG - Intergenic
1178649785 21:34412059-34412081 AGAACTCTCAAGGGTTCCCTAGG - Intergenic
1179056822 21:37944046-37944068 AGAGCTGTCAAAGATCCCCAGGG - Intergenic
1180135490 21:45859505-45859527 CCAGCTGTCCAGGGTCCCAAGGG - Intronic
1180993154 22:19950768-19950790 GGAGATCTCAAGTATCCCAAAGG + Intronic
1181467912 22:23120183-23120205 AGAGGTGTCCAGGGTCCCCAAGG + Intronic
1184424723 22:44402815-44402837 AGAACACTCATGGGTCCCACTGG + Intergenic
949263183 3:2126162-2126184 AGAGATCCCAAGGGTCCCTAAGG - Intronic
950160122 3:10754160-10754182 GGAGCTCTCCAGGGTCCTGACGG - Intergenic
951998407 3:28756870-28756892 AGAGGTCTCAAAGGTCTGAAAGG - Intergenic
952657551 3:35804013-35804035 AGAGCTGTCATGGATCTCAAAGG - Intergenic
959598335 3:108152011-108152033 AGAGGACCCAAGGGTCCCCAAGG - Intergenic
959964508 3:112337775-112337797 AAAGCCCCCATGGGTCCCAAGGG - Intronic
960344362 3:116514120-116514142 AGGGCTCTCAAGGGGCAAAAGGG + Intronic
960990934 3:123310723-123310745 AAAGCACTCAAGGGTCCCTAAGG + Intronic
962389589 3:134960106-134960128 AGATCTCTCAGGGCTCCTAAGGG - Intronic
972128692 4:35802241-35802263 AGAGCTCTTATGGGTCTCAGAGG - Intergenic
977170364 4:93753805-93753827 AGGGCTCTCAAGATTCCCCAGGG - Intronic
984031975 4:174615153-174615175 AGAGCACTACAGTGTCCCAAGGG - Intergenic
985025737 4:185737557-185737579 CGAGCTCTCATGGGTCTCACAGG - Intronic
989195342 5:38710999-38711021 AAAGCTCTCATGTGTCTCAAAGG - Intergenic
989584983 5:43067499-43067521 AGAGCCCTCCAGGCTCCTAAGGG + Intronic
993074434 5:83210859-83210881 AGAACTCTCAAATGTCCCAAAGG + Intronic
994999527 5:107109558-107109580 AGAGCTCTTCAGAGTCTCAATGG - Intergenic
1000630722 5:163587535-163587557 AGAGCTCTCAGAGGACCCACTGG + Intergenic
1001134279 5:169089630-169089652 AGAGCTCTCCAGGGTCTGAAAGG - Intronic
1001414133 5:171531538-171531560 AAAAATCTCAAGGGTCTCAAGGG - Intergenic
1002423193 5:179160898-179160920 AGCTCTCTGAAGGGTCTCAATGG - Intronic
1004639779 6:17503992-17504014 AGTGCTCTCAAGGTTCCCAGTGG - Intronic
1007178784 6:39913684-39913706 AGGGCTCTCAAGTGGGCCAAGGG + Intronic
1007252791 6:40507591-40507613 TGAGGTTCCAAGGGTCCCAACGG - Intronic
1008718492 6:54319083-54319105 AGACATCTCAAGGGTCCTTAAGG - Intronic
1011826677 6:91314887-91314909 AGAGCTCACTAAAGTCCCAAAGG + Intergenic
1017818546 6:158032261-158032283 TGAGCTCTGATGGGTCCCAGGGG - Intronic
1022488072 7:30795517-30795539 AGACCTCTCCAGGGTCACACAGG + Intronic
1023463022 7:40421185-40421207 AGACCTCTGAAGGGTGCCAACGG - Intronic
1024827423 7:53407806-53407828 AGAGCTCTGGAGGGGCCCCATGG - Intergenic
1027139431 7:75646793-75646815 ACAGCTCTCAGGGTTCCCCAGGG - Intronic
1028655142 7:93196447-93196469 AGAGCTGGCAAGGGCCCCAGAGG - Intronic
1029515694 7:101021740-101021762 AAAGCTGGCCAGGGTCCCAAAGG - Intronic
1029560566 7:101300131-101300153 GGCGCTCTCAGGAGTCCCAAAGG + Intergenic
1029561978 7:101308827-101308849 GGCGCTCTCAGGAGTCCCAAAGG + Intergenic
1029973765 7:104814439-104814461 AGAGCTTTTAAGGGCCTCAAAGG + Intronic
1036629388 8:10499837-10499859 AGAGCTCTCAAGGGCAGCAATGG + Intergenic
1037434051 8:18844263-18844285 AGAATTCTCAGGGGACCCAAGGG - Intronic
1039120146 8:34136506-34136528 GGAATTCACAAGGGTCCCAAGGG - Intergenic
1046737856 8:117796180-117796202 GGAGATCTCAAGAGACCCAAGGG + Exonic
1048558362 8:135505382-135505404 AGAGCTCTCAAGGGTCCCAAGGG - Intronic
1048603431 8:135943157-135943179 TGAGCACTCAAAGGTACCAAAGG + Intergenic
1056898810 9:90579409-90579431 AGAGCTCTCATGGGGTCCAGAGG + Intergenic
1057078138 9:92151598-92151620 ATAGCTCTCAAGGATCCAAGCGG + Intergenic
1060553646 9:124497519-124497541 TGAGCTCTCAGGGGTGCCAGGGG - Intronic
1061963994 9:134003090-134003112 GGAGGTCTCAGGGGTCCCAGAGG + Intergenic
1062015608 9:134289643-134289665 TGTCCTCCCAAGGGTCCCAAGGG + Intergenic
1062511356 9:136907913-136907935 ATAGCTCTCAGGGCTCCCACAGG - Intronic
1185546190 X:947611-947633 GGATCCCTCAAGGGTCCCAAGGG + Intergenic
1185546204 X:947682-947704 GGATCCCTCAAGGGTCCCAAGGG + Intergenic
1185546218 X:947753-947775 GGATCCCTCAAGGGTCCCAAGGG + Intergenic
1188967149 X:36568469-36568491 AGAGCTTTCCAGGGTCCCTCAGG - Intergenic
1189363825 X:40372721-40372743 AGTGCTCTCAACAGTCCCCATGG + Intergenic
1189670758 X:43406319-43406341 AGAGCTCCCAATGGCCACAATGG - Intergenic
1191054373 X:56227218-56227240 AGGGCTCTGAAGGCCCCCAAAGG - Intergenic
1191109761 X:56795250-56795272 AGAGCTCTCTGGGGTCCTCAAGG + Intergenic
1193298509 X:79860784-79860806 AGAGCTCTAAAGTGTCTCAGAGG - Intergenic
1193348553 X:80431335-80431357 AGAGCTGACAAGGCTCCCCAAGG + Intronic
1198403651 X:136291256-136291278 AGAACTCTGATGGGTGCCAAGGG + Intergenic
1198510126 X:137341989-137342011 GGAGCTGACAAGGGTCACAAAGG + Intergenic
1200202904 X:154294992-154295014 AGAACTCGCATGGCTCCCAACGG - Intronic