ID: 1048558363

View in Genome Browser
Species Human (GRCh38)
Location 8:135505383-135505405
Sequence GAGAGCTCTCAAGGGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558363_1048558369 1 Left 1048558363 8:135505383-135505405 CCTTGGGACCCTTGAGAGCTCTC 0: 1
1: 0
2: 3
3: 17
4: 163
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558363 Original CRISPR GAGAGCTCTCAAGGGTCCCA AGG (reversed) Intronic
900592445 1:3466058-3466080 GAGAGGTCTCTGGGGTCCCAGGG + Intronic
900802136 1:4743926-4743948 GAGAGCTCTCCAGGCTCTCCAGG + Intronic
902615605 1:17621953-17621975 GGGAGTTCTCAAGGGTCTCTGGG + Intronic
902830253 1:19007897-19007919 GAGAGCATGCCAGGGTCCCAGGG - Intergenic
903848404 1:26291760-26291782 GAGAGTTCTCAAGGGACCCCTGG - Intronic
905801829 1:40849213-40849235 CAGAGCTGCCAAGGCTCCCAAGG + Intergenic
905902237 1:41589266-41589288 GAGAGCTCTCACTGGCCTCATGG - Intronic
908633300 1:66134348-66134370 CAGAACTCTCAAAGGTACCACGG + Intronic
911578981 1:99613230-99613252 AAGAGCTCTGAAGAGTCCAAGGG - Intergenic
913983778 1:143547014-143547036 GAATGCTCTCAAGGGCCCCTGGG - Intergenic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922290589 1:224206069-224206091 GAGAGCTCTCAGGAGTCCTGGGG - Intergenic
922547974 1:226472818-226472840 CACAGCTCTAAAGGGGCCCAGGG - Intergenic
922699615 1:227751118-227751140 GGGAGCACTAAAGGGGCCCAGGG - Intronic
922794278 1:228332312-228332334 GGGAGCTCTCTGGGGTCCCATGG + Intronic
1063334201 10:5195325-5195347 GAAAGCTCTCAAATCTCCCATGG - Intergenic
1064494324 10:15892329-15892351 AAGAGATCTCAAGGATCCCAAGG + Intergenic
1065908658 10:30282161-30282183 GAGTGCCCTCAAGAGTCTCATGG + Intergenic
1067431389 10:46248232-46248254 CAGGGCTCTCCAGGGACCCAGGG + Intergenic
1067442020 10:46313968-46313990 CAGGGCTCTCCAGGGCCCCAGGG - Intronic
1067451828 10:46386445-46386467 CAGAGCTCTCATGGGTTCCAGGG + Intronic
1067585410 10:47473310-47473332 CAGAGCTCTCATGGGTTCCAGGG - Intronic
1070383526 10:75902884-75902906 GGGAGCTCTGAAGGGCCCCTGGG - Intronic
1071523617 10:86345858-86345880 GTGAGCTGTCCAGGGTCCCTGGG - Intronic
1072577945 10:96717531-96717553 GAGAGGCCTCAAGGATCACATGG + Intronic
1073028483 10:100506125-100506147 GAGAACACTGAAGGGTCCCGAGG + Exonic
1074905909 10:117863471-117863493 CACTGCTCTCAAGGGTCCCGTGG - Intergenic
1075633852 10:124017311-124017333 GAGAGAACTCAGTGGTCCCAGGG + Intronic
1076115252 10:127891119-127891141 GAGAGCCCTGAAGGGGCCCAGGG - Intronic
1077406624 11:2385313-2385335 CAGAGATCCCAAGGGCCCCAGGG - Intronic
1082776642 11:57250194-57250216 GAGTGATCTTCAGGGTCCCAGGG - Intergenic
1083177974 11:60964673-60964695 GAAAGATTTTAAGGGTCCCAAGG + Intergenic
1084019553 11:66409490-66409512 CAAAGGTCTCCAGGGTCCCATGG - Intergenic
1085280383 11:75326092-75326114 AGGAGCTCTGCAGGGTCCCAGGG + Intronic
1087094812 11:94308016-94308038 GGGAGCTTTCAAGGGGCTCAAGG + Intergenic
1087389986 11:97519684-97519706 GGGAGTTTGCAAGGGTCCCATGG - Intergenic
1087597582 11:100273150-100273172 GAGGCCTCTCAAGGCTCCCGAGG - Intronic
1087675199 11:101153677-101153699 GAGAGCTCAGAAGTGACCCAGGG - Intergenic
1087704721 11:101477261-101477283 GAGAGCTGAGAAGGGTCTCAAGG - Intronic
1087832684 11:102836693-102836715 CAGAGCACTAAAGGGTCCCCTGG - Intronic
1090416773 11:126545825-126545847 AAGAGCTTTCAAGGGTTGCAGGG + Intronic
1090934102 11:131326637-131326659 GAGAACTCTCCAGGGTTCCCGGG - Intergenic
1091165049 11:133468206-133468228 GCCACCTCTCCAGGGTCCCATGG + Intronic
1091355523 11:134934782-134934804 GAGAGCTCACAGGGGGTCCAAGG + Intergenic
1099850653 12:88091729-88091751 GAGAACTATCAAGGCTCCAAAGG + Intronic
1101819376 12:108172076-108172098 GACAGCCCTCTAGGGTCCAAGGG - Intronic
1102049820 12:109854738-109854760 TGGAGCTCTCGAGGGGCCCATGG + Intronic
1104648952 12:130517280-130517302 GAGGACTCTGTAGGGTCCCAAGG - Intronic
1104795463 12:131514079-131514101 TAGCGGTCTCAAGGGTGCCAGGG + Intergenic
1108571274 13:51754159-51754181 GAGAGCTCAAAAGGGTTCAATGG - Intronic
1112436172 13:99392712-99392734 GAGAGCTCCCATGGGTGCGAGGG + Intergenic
1114459116 14:22875704-22875726 GGGAGCTCTCAGGGGGCCCAGGG - Exonic
1116980767 14:51167722-51167744 GAGAGCTCTCAAGGCTTCTTAGG - Intergenic
1118385356 14:65251639-65251661 AGGGGCTCTCCAGGGTCCCAGGG - Intergenic
1118780849 14:69006545-69006567 GAGAGTTCTGAGGGGACCCAGGG + Intergenic
1120975118 14:90241646-90241668 GGGAGCTTGCAAGGGTCCCATGG + Intergenic
1121182687 14:91941556-91941578 GAGAGGGTTCAGGGGTCCCAGGG + Intronic
1124484793 15:30104273-30104295 GGGAGCTCTCTTGGGACCCATGG + Intergenic
1126645674 15:50872670-50872692 GGGAGTTTGCAAGGGTCCCATGG - Intergenic
1129676699 15:77635493-77635515 GAGTCCTCTCAGGGGTCCCAGGG + Intronic
1131395059 15:92079420-92079442 GAGAGTTCTTAAGAGACCCATGG - Intronic
1134178806 16:12030940-12030962 GAGAGGTCTCAAGAGTCCCAAGG - Intronic
1135187049 16:20324100-20324122 GAGAACTCAGCAGGGTCCCAGGG - Exonic
1135305549 16:21364682-21364704 GAGAGGTCTCAAGAGTCCCAAGG - Intergenic
1136302290 16:29343835-29343857 GAGAGGTCTCAAGAGTCCCAAGG - Intergenic
1136779737 16:32889593-32889615 GAGAGCACTACAGTGTCCCATGG + Intergenic
1136890876 16:33971925-33971947 GAGAGCACTACAGTGTCCCATGG - Intergenic
1137447944 16:48543559-48543581 GAAAGCTCCCAAGGGTACCCTGG - Intronic
1138439271 16:57024514-57024536 GAGAGGTCTCAGGTGACCCAGGG - Intronic
1140953095 16:79837909-79837931 GAGTGGTCTGAAGGCTCCCATGG + Intergenic
1141123780 16:81385456-81385478 GGAAGCTCTTAAGGCTCCCAAGG + Exonic
1141672077 16:85497414-85497436 TAGAGCCCTCCAGGGGCCCACGG + Intergenic
1203082157 16_KI270728v1_random:1151681-1151703 GAGAGCACTACAGTGTCCCATGG + Intergenic
1145824174 17:27864269-27864291 GAGAGCTGTGTAGTGTCCCATGG + Intronic
1146006753 17:29165443-29165465 GAGCTCTCTCAAGGGCTCCAGGG + Intronic
1147561801 17:41513895-41513917 GAGAGCTGAAAAGGGTCCCTCGG - Exonic
1148127983 17:45246647-45246669 CAGTTCTCCCAAGGGTCCCAGGG - Intronic
1148203988 17:45768182-45768204 GTGAGCTGTCCAGGGTCCCTGGG + Intergenic
1148443979 17:47726791-47726813 CAGACCTCTCACAGGTCCCAGGG + Intergenic
1152528058 17:80900878-80900900 GGAAGCTCTCAATGGTGCCATGG - Intronic
1153988822 18:10376935-10376957 GAGAGCTGTCAGGGTTTCCAAGG - Intergenic
1157807235 18:50667229-50667251 GACAGCTTTCAAGGGGCCAAGGG - Intronic
1159632390 18:70763966-70763988 GCCAGCTCTCAAGGGTCACTGGG + Intergenic
1161812684 19:6479609-6479631 CAGATCTCTCAGGGGCCCCAAGG - Intronic
1164439363 19:28260928-28260950 GAGAGCTCTTGAGGAACCCATGG - Intergenic
1165749244 19:38250377-38250399 GAGAGGCCTGGAGGGTCCCAAGG - Intronic
1165797283 19:38526486-38526508 GAGAGCCCTCCAGGGCTCCATGG + Intronic
1166148188 19:40851306-40851328 GAAAAATCTCAAGTGTCCCAAGG + Intronic
1166152330 19:40883091-40883113 GAAAAATCTCAAGTGTCCCAAGG + Intronic
1166177847 19:41087569-41087591 GAAAAATCTCAAGTGTCCCAAGG - Intergenic
1166529165 19:43532513-43532535 GAGAGCTAGAAAGGGTCACACGG + Intronic
1166946614 19:46401147-46401169 GGGACCTCTCCAGGGTCACAAGG - Intergenic
925719243 2:6811844-6811866 GTGAGCACACAATGGTCCCATGG - Intergenic
929759147 2:44791707-44791729 CAGAGATCTGAAGGGTACCAAGG + Intergenic
929919509 2:46162253-46162275 GGGAGCTCCCAAGAGGCCCAAGG - Intronic
929967982 2:46549758-46549780 CTGAGCTCTCAGGGGTCCCCCGG + Intronic
931417813 2:62098072-62098094 GGGAGTTTGCAAGGGTCCCATGG - Intronic
937232140 2:120404465-120404487 GAGAGCCCCCAAGGCTCCAAAGG + Intergenic
937626367 2:124048529-124048551 GAGAGCCCTCAAATGTCCAATGG - Intronic
938635345 2:133219449-133219471 AAGATCTCTCAGGGGTCCAAGGG + Intronic
939237212 2:139511012-139511034 GAGAGCTCTCAAGAGGCTAAAGG - Intergenic
940538569 2:154980100-154980122 GACATCTTTAAAGGGTCCCAAGG + Intergenic
941653398 2:168117795-168117817 GGGATCACTCCAGGGTCCCATGG - Intronic
942398764 2:175579407-175579429 GTGACCTCTGAAGGTTCCCATGG + Intergenic
942791011 2:179760597-179760619 GATAGCACTCACGGGTTCCAAGG - Intronic
944457293 2:199908759-199908781 GAGAACTCTCAAGAGTCCAGAGG + Intergenic
946112384 2:217431454-217431476 TAGATTTCTGAAGGGTCCCAGGG + Intronic
947535960 2:230940611-230940633 GTGAGCTCTCAGGGGTCACTGGG + Intronic
948365061 2:237449339-237449361 GGGAGCTGTCAAGGATTCCACGG - Intergenic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948850247 2:240702163-240702185 GAGAGGGCTGCAGGGTCCCAGGG + Intergenic
1170546569 20:17439902-17439924 CACAGCTGTCACGGGTCCCAGGG + Intronic
1172188052 20:33043862-33043884 GTGACCTCTCCAGGGTCACAAGG + Intronic
1173255895 20:41394217-41394239 CAGAGCTCGGAGGGGTCCCAGGG + Intergenic
1173336945 20:42119882-42119904 GAGAGGCTTCAGGGGTCCCAGGG - Intronic
1174522297 20:51141115-51141137 AGGTGTTCTCAAGGGTCCCACGG + Intergenic
1174538585 20:51271919-51271941 GAGAGCTCTGGAGGAACCCAAGG + Intergenic
1175984935 20:62759963-62759985 GAGAACTCTTGAGGGCCCCAAGG - Intronic
1175998165 20:62820565-62820587 ACGAGCTCCCAAGGGTCCCAAGG - Intronic
1179056823 21:37944047-37944069 GAGAGCTGTCAAAGATCCCCAGG - Intergenic
1180135492 21:45859506-45859528 GCCAGCTGTCCAGGGTCCCAAGG - Intronic
1181168388 22:20995139-20995161 GAGAGCACTCTGGGGTCCCATGG - Intronic
1181489322 22:23251782-23251804 GTGAGCTCTCAGAAGTCCCATGG + Intronic
1183023611 22:35047229-35047251 GTGTGCTTTCAAGGGTCTCACGG + Intergenic
1184073465 22:42161427-42161449 GAAAGCTCCCAGGGGTACCACGG - Intronic
950424091 3:12915271-12915293 GAGCTCTCTGAGGGGTCCCAGGG + Intronic
950471605 3:13189821-13189843 GACAGCTCACATGGGTCTCAGGG - Intergenic
950637402 3:14324560-14324582 GAGAGATCCCAGGAGTCCCAGGG + Intergenic
953245841 3:41191045-41191067 GATAACTCTCCAGTGTCCCATGG + Intergenic
955476453 3:59341261-59341283 CAGCCCACTCAAGGGTCCCAAGG + Intergenic
956346261 3:68282490-68282512 AAGAGCTTTCAAGGTTCCCCAGG + Intronic
960543535 3:118886730-118886752 GAGAGCACTCTAGAGTCTCATGG + Intergenic
964427771 3:156571290-156571312 AAGAGCTCTCCAGTGTCCTAGGG + Intergenic
965833585 3:172826438-172826460 GAAAGCACTCAAGAGTCTCATGG - Intergenic
966219304 3:177534737-177534759 GAGAGCTGGCAAGGGTCGGATGG - Intergenic
966636792 3:182143801-182143823 GAAAGCTCACAAGGATACCAAGG + Intergenic
969606730 4:8205692-8205714 GAGGACTCTCAGGGGTTCCAAGG - Intronic
969626941 4:8310463-8310485 GAGGGCTCTAAAGGGTCCCCAGG - Intergenic
969935455 4:10675468-10675490 AAGAGTTCTCAAGGGTAACAAGG - Intronic
974594682 4:64000088-64000110 GGGAGTTTGCAAGGGTCCCATGG - Intergenic
975250589 4:72174045-72174067 GGGAGTTTGCAAGGGTCCCATGG + Intergenic
982959831 4:161822850-161822872 AACAGCTCTCAGGAGTCCCAAGG + Intronic
986335493 5:6752176-6752198 CTGGGCTCTCAAGGGCCCCAAGG - Intronic
992894221 5:81232987-81233009 CAGAGCTCACCAGGGCCCCAAGG + Intergenic
998936984 5:147239866-147239888 GAAAGCTGCCAAAGGTCCCATGG - Intronic
999367290 5:151031419-151031441 TAGAGCTCTCATGGGGCACAAGG - Intronic
1001312065 5:170618289-170618311 GAGAGCTCAGGAGGGTCCCTAGG + Intronic
1004126331 6:12877601-12877623 CAGAACTCTGAAGGGTCCCTAGG + Intronic
1007168761 6:39847570-39847592 GAGAGCTCTCCATGCTCCCCAGG + Intronic
1007178783 6:39913683-39913705 GAGGGCTCTCAAGTGGGCCAAGG + Intronic
1011260855 6:85468403-85468425 CACAGCTCTCAAGGGGACCAAGG - Intronic
1017649271 6:156566029-156566051 GAGAGCACTCAAGGGTACAGTGG + Intergenic
1017818547 6:158032262-158032284 GTGAGCTCTGATGGGTCCCAGGG - Intronic
1022990174 7:35698935-35698957 GAGAACTCTCAAGAGTACCATGG + Intergenic
1023034153 7:36116132-36116154 GTGTGCTCTCCAGGGGCCCAGGG + Intergenic
1026560906 7:71447882-71447904 GAGAGCTCCCCAGGGTGCTATGG + Intronic
1030484245 7:110146416-110146438 CAGAGCTCTCAAGGAGCCCCTGG - Intergenic
1032428051 7:131837746-131837768 AAGAGCTCTCTAGGGCTCCAAGG - Intergenic
1036703750 8:11031323-11031345 GAGAGATCTCAGGAGACCCAAGG - Intronic
1038256363 8:25954707-25954729 GAGAGTTCTGAAGGCTCCCTGGG - Intronic
1038438756 8:27557299-27557321 GAAAGTCCACAAGGGTCCCAGGG + Intergenic
1039120147 8:34136507-34136529 GGGAATTCACAAGGGTCCCAAGG - Intergenic
1045007270 8:97927564-97927586 CTGAGCCCTCAAGGGACCCAAGG + Intronic
1046511686 8:115212014-115212036 GAACTCTCTGAAGGGTCCCAAGG - Intergenic
1048558363 8:135505383-135505405 GAGAGCTCTCAAGGGTCCCAAGG - Intronic
1051711470 9:19934909-19934931 GAGAGCTGGCAGGGGTCTCATGG + Intergenic
1053010006 9:34627770-34627792 GAGAGCCGTCCAGGGGCCCAGGG - Exonic
1057198514 9:93128190-93128212 GAGAGCACACCAGGGCCCCAGGG - Intronic
1057399968 9:94714641-94714663 GAGAGTTCTGCAGGCTCCCAGGG + Intergenic
1058747451 9:108005666-108005688 GAGACCTTTCCAGGGTACCAGGG + Intergenic
1059524567 9:114978656-114978678 GAGAGCTCTGCAGAGCCCCAAGG - Intergenic
1060246456 9:121950596-121950618 GTGAGCTCTCAAGTGTCCCCGGG - Intronic
1060553647 9:124497520-124497542 CTGAGCTCTCAGGGGTGCCAGGG - Intronic
1062480609 9:136749160-136749182 GAGAGCTCTCAAGGGGCCTTGGG - Intergenic
1062596917 9:137303682-137303704 AGGAGCTCTCAAGGGGGCCACGG + Intergenic
1185476058 X:416301-416323 GAGAAGTCTCCAGGGCCCCAGGG - Intergenic
1185546189 X:947610-947632 TGGATCCCTCAAGGGTCCCAAGG + Intergenic
1185546203 X:947681-947703 TGGATCCCTCAAGGGTCCCAAGG + Intergenic
1185546217 X:947752-947774 TGGATCCCTCAAGGGTCCCAAGG + Intergenic
1189369402 X:40415930-40415952 TGGAGCTGGCAAGGGTCCCAGGG + Intergenic
1190042559 X:47082908-47082930 TGGAGCCATCAAGGGTCCCAAGG - Intronic
1192207724 X:69107275-69107297 GAGGGCTTGCCAGGGTCCCAGGG - Intergenic
1198403650 X:136291255-136291277 GAGAACTCTGATGGGTGCCAAGG + Intergenic
1200235745 X:154466978-154467000 GAGAGCGATCAAGGCTGCCATGG - Intronic