ID: 1048558365

View in Genome Browser
Species Human (GRCh38)
Location 8:135505391-135505413
Sequence CCCTGAAGGAGAGCTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558365_1048558369 -7 Left 1048558365 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG 0: 1
1: 0
2: 1
3: 28
4: 274
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558365 Original CRISPR CCCTGAAGGAGAGCTCTCAA GGG (reversed) Intronic
901379870 1:8865897-8865919 CCCTGAGCCTGAGCTCTCAACGG - Intronic
904179424 1:28655510-28655532 CCCTGAAGGACAGCGGTGAAGGG - Intergenic
905902238 1:41589274-41589296 CTCTGAGCGAGAGCTCTCACTGG - Intronic
906930858 1:50168048-50168070 CCCTGAAGGACAGCGGTGAAGGG - Intronic
907780406 1:57561296-57561318 CCCTGAAGGACAGCAGTGAAGGG + Intronic
908575851 1:65459302-65459324 CCCTGAAGGGCAACTCTCAGAGG - Intronic
909548883 1:76876723-76876745 CCCTGAAGGACAGCAGTGAAGGG - Intronic
909576989 1:77186318-77186340 CCCTGAAGGACAGCGGTAAAGGG + Intronic
910526174 1:88180930-88180952 CCCTGAAGGAAAGAGCTCAAGGG - Intergenic
911881394 1:103243166-103243188 CCCTGAAGGAGAAGCCTTAAAGG + Intergenic
912212312 1:107569353-107569375 CCCTGAAGGACAGTGCTGAAGGG + Intergenic
912877099 1:113371126-113371148 CCCTGAAGGAGGGCGAACAAAGG - Intergenic
913202802 1:116509602-116509624 CCCTCCAGCAGAGCTGTCAAGGG - Intergenic
914340268 1:146754252-146754274 CCATGACTGTGAGCTCTCAAAGG - Intergenic
915709724 1:157884104-157884126 CCCTGAAGGACAGCAGTGAAAGG + Intronic
917462765 1:175246617-175246639 CCCTGAAGGACAGCAATGAAGGG + Intergenic
918259531 1:182782973-182782995 AGCTTAAGGAGAGCTCTCAGTGG + Intergenic
918755648 1:188337346-188337368 CCCTGAAGGATAGCAGTGAAGGG - Intergenic
918774553 1:188611210-188611232 CCCTGAAGGAGAGCAGTAAAGGG + Intergenic
918815136 1:189171682-189171704 CCCTGAAGGACAGCTGTGAAGGG + Intergenic
919241834 1:194924663-194924685 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
920558606 1:206922720-206922742 TCCTGAAGGAGAGCTCTACCAGG - Intronic
920718814 1:208367718-208367740 CCCTGAAGATGAGCTCTGGAGGG + Intergenic
921393710 1:214645414-214645436 CCTTGAAGAAGAACTCTCAGTGG + Exonic
921986391 1:221317361-221317383 CCCTGAAGGACAGTGGTCAAGGG + Intergenic
922385158 1:225074555-225074577 CCCTGGGAGAGAGCTCCCAAAGG - Intronic
924450011 1:244169572-244169594 CCCTGATGGAGAGCTCGGCAGGG - Intergenic
924840715 1:247707374-247707396 CCCTGAAGGACAGCGGTGAAAGG - Intergenic
1062798459 10:361791-361813 CCCTCAGGGAGTGCTCTGAAAGG - Intronic
1063327262 10:5116732-5116754 CCCTGAAGGACAGCAATGAAGGG - Intronic
1064940647 10:20731582-20731604 CCCTGGAGGGTAGCTCTCAATGG + Intergenic
1067754291 10:48993264-48993286 CCCTGAAGGACAGCGGTGAAAGG - Intergenic
1069588617 10:69628162-69628184 CCCTGAAGTAGATCACCCAAAGG - Intergenic
1071267017 10:83973544-83973566 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1071378439 10:85033819-85033841 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1071937749 10:90549738-90549760 CCCTGAAGGAGAGCAATGAAGGG + Intergenic
1072209192 10:93231221-93231243 CCCTGAAGGAGACCAGTGAAGGG - Intergenic
1073656624 10:105424032-105424054 CCCTGAAGGACAGCGGTGAAAGG - Intergenic
1075606850 10:123817860-123817882 CCCTGAAGGACAGCACTGAAGGG + Intronic
1075973528 10:126674721-126674743 GCCAGAAGGAGAGCTCTCATGGG + Intergenic
1078483330 11:11699450-11699472 TACAGAAGGAGAGCTCTCCATGG - Intergenic
1080642731 11:34167144-34167166 CCCTGAATCAGAGATCCCAAAGG - Intronic
1081609123 11:44548314-44548336 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1084458198 11:69281041-69281063 CCCTCAAGGATAGCTGACAAAGG - Intergenic
1085100556 11:73796614-73796636 GCCTGAAGGTGGGGTCTCAATGG - Intronic
1086141577 11:83505767-83505789 CCCTGAAGGACAGCCATGAAGGG - Intronic
1086843006 11:91711855-91711877 CCCAGAAGGGGAGCCCTCATTGG - Intergenic
1086983909 11:93227631-93227653 CCCTCCAGGAGAACTCTCAAGGG + Intergenic
1087139827 11:94754333-94754355 CCCAGAGGAAGAGCTCACAATGG - Intronic
1088097270 11:106115593-106115615 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1088265476 11:107984034-107984056 CCCTGAAGGAGAACAGTGAAGGG + Intergenic
1088322920 11:108571600-108571622 TGCTGAAGGGGAGCTCCCAAGGG + Intronic
1088449414 11:109965804-109965826 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1088836724 11:113583825-113583847 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1089293645 11:117454866-117454888 CCATGAAGGACAGCACTCTAAGG - Intronic
1090209431 11:124907619-124907641 CCCTGAAGGATAGCAGTGAAGGG - Intergenic
1090629524 11:128633843-128633865 CCCAGAAAGAGAGCTGTCACTGG - Intergenic
1090753935 11:129772165-129772187 CCCTGAAAGACAGCTGTGAAGGG - Intergenic
1091207456 11:133831532-133831554 CCCTGAGGGAGGGCTCTCTGGGG - Intergenic
1091317457 11:134624562-134624584 CCCTCAAGGAAAACTATCAATGG + Intergenic
1091851127 12:3697883-3697905 CCCTGAAGGAGTGTTTTCAGAGG + Intronic
1094102589 12:26779699-26779721 CCATGAAGGAGAGCAGTGAAGGG + Intronic
1095121449 12:38424408-38424430 CCCTGAAGGACAGCGGTGAAGGG - Intergenic
1095844328 12:46729538-46729560 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1096288775 12:50323392-50323414 CCCTGAAGGAGAGCAGTGAAGGG + Intergenic
1096457400 12:51799000-51799022 CCCTGAAGGAGAGCACTGAAGGG - Intronic
1096896977 12:54830758-54830780 CTCTTAAGGAGAGCCCCCAATGG - Intronic
1097077060 12:56402878-56402900 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1099490614 12:83283815-83283837 CCCTGAAGGACAGTCCTGAAAGG - Intergenic
1099508624 12:83507624-83507646 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1099633633 12:85182894-85182916 ATCTGAAGGAGTGCTCTCCATGG + Intronic
1100232019 12:92618367-92618389 CCCTGAAGGAGAGTGATGAAGGG + Intergenic
1105654645 13:22423066-22423088 CTCTGAAAGGGAGCTCTCAGAGG - Intergenic
1105740179 13:23315617-23315639 CCCTGAAGGACAGCAGTGAAGGG + Intronic
1106680496 13:32002062-32002084 TCCTGCAGGAGAGCTCTCTATGG - Intergenic
1108914244 13:55588437-55588459 GCCTGAAGGACAGCGCTGAAGGG - Intergenic
1109950962 13:69501771-69501793 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1110035135 13:70673173-70673195 CCCTGAGACAGAGCTCTCAGAGG - Intergenic
1111717253 13:91895132-91895154 CATGGAAGCAGAGCTCTCAAGGG + Intronic
1112231067 13:97589729-97589751 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1113789444 13:113019831-113019853 GCCTCAAGGAGACCTCTGAATGG + Intronic
1115059773 14:29174330-29174352 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1115863977 14:37722421-37722443 CCCTGAAGGTCTGCTCTCAAGGG - Intronic
1117634194 14:57724810-57724832 CCCTGAAGGACAGCGATGAAAGG + Intronic
1118122378 14:62859733-62859755 CCCTGAAGGACAGCAGTGAAGGG - Intronic
1119210889 14:72830996-72831018 CCCTGAAGAAAGGCTCTCATAGG - Intronic
1120555931 14:85930002-85930024 CCCTGAAGGACAGCAGTGAAAGG - Intergenic
1125933610 15:43616757-43616779 CCCTGACTCAGAGCCCTCAAGGG + Intronic
1125946708 15:43716219-43716241 CCCTGACTCAGAGCCCTCAAGGG + Intergenic
1127264291 15:57348996-57349018 CCATGAGGGAGTGCTCTCCATGG + Intergenic
1127331008 15:57940174-57940196 CCCTGAGACAGAGCTCTCAGGGG - Intergenic
1129133615 15:73524897-73524919 CCCAAAAGCAGAGCTTTCAATGG + Intronic
1129681203 15:77659409-77659431 CCCTCAAGCAGAGGTCTCAAGGG + Intronic
1130575731 15:85091659-85091681 CCCTGAATATGAGCTCTCTAAGG - Intronic
1137484821 16:48882227-48882249 CCCTGGAGGAGAGCCTCCAATGG + Intergenic
1139711376 16:68779112-68779134 CCCTGAAGGCCTGCTCTAAATGG + Intronic
1140343648 16:74190569-74190591 CCCTGAAGGATGGCTCTCTCAGG - Intergenic
1141776731 16:86128048-86128070 CCCTGGGGTACAGCTCTCAAGGG + Intergenic
1146836418 17:36114422-36114444 CCCTGAAGGAGAGCAGTGAAGGG + Intergenic
1148789304 17:50164459-50164481 CCCTGGAGGAGAGGTCACACAGG + Intronic
1149412480 17:56422964-56422986 CCCTGCAGCAGAGTTCTCCAGGG + Intronic
1149786245 17:59437651-59437673 CCCTGAGGGAAAGCACACAAAGG - Intergenic
1150931950 17:69594629-69594651 TGCTGAAGGAGAGCTCAGAAGGG - Intergenic
1153966796 18:10189883-10189905 CACTGGAGCAGAGCTCTGAATGG + Intergenic
1154073787 18:11179322-11179344 CCCCAAAGGAGAACTCTAAATGG - Intergenic
1155917839 18:31573451-31573473 TCCTGAAGAAAAGCTCTCGAGGG - Intergenic
1155940824 18:31800350-31800372 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1156606426 18:38672196-38672218 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1156804188 18:41156639-41156661 CCCTAAAACATAGCTCTCAATGG - Intergenic
1156889212 18:42170577-42170599 AGCTGAAGGAGAACTCACAATGG + Intergenic
1156990245 18:43400342-43400364 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1157341267 18:46780457-46780479 CCCTGAAGGATAGCGGTGAAGGG + Intergenic
1159112872 18:64080147-64080169 CCCTGCATGAGACCTTTCAATGG + Intergenic
1163746943 19:19054340-19054362 CCCAGAAGGACAGCACGCAATGG - Intronic
1163806310 19:19400404-19400426 CCCTGAAAAACAGCTCTCTAGGG - Intronic
1166248370 19:41547127-41547149 GCCTGACAGACAGCTCTCAAGGG + Intergenic
925842940 2:8009433-8009455 CCCTGGAGGAGAACCCTCACAGG + Intergenic
927035848 2:19175368-19175390 CCCTGGAGGAGACCTATCCAAGG - Intergenic
928088888 2:28362072-28362094 CCCTGAAGGAACCCTCTCATGGG + Intergenic
930910204 2:56621303-56621325 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
931460600 2:62447252-62447274 TCCTGATGCAGAGCTCTCAGAGG - Intergenic
932649001 2:73534929-73534951 ACCTGAATGGGAGCTTTCAACGG - Exonic
933504716 2:83162325-83162347 CCCTGAAGGACAGCGGTGAAGGG - Intergenic
933992886 2:87646467-87646489 CACTGCAGGAGAGCCCTCAGCGG - Intergenic
936300970 2:111304412-111304434 CACTGCAGGAGAGCCCTCAGCGG + Intergenic
937582000 2:123498715-123498737 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
937671458 2:124541843-124541865 TCCAGAAGAAGAGGTCTCAAGGG + Intronic
937852508 2:126648303-126648325 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
939788622 2:146545676-146545698 CCCTGAAGGAAAGCGTTGAAGGG - Intergenic
940831439 2:158470789-158470811 CCATGTAGAAGAGCCCTCAAGGG - Intronic
940967716 2:159858639-159858661 CCCTGAGCAAGAGCCCTCAAAGG + Intronic
941245314 2:163088580-163088602 CCCTCTAGGAGAGCCCTCACAGG - Intergenic
942154964 2:173119121-173119143 CACTGAGGGAGAGCACTTAAGGG + Intronic
942439628 2:176019321-176019343 GTCTGAAGGGGAGCTCTGAAAGG - Intergenic
945437031 2:209830915-209830937 CCCTGCAGGGAAGCTCTCAAAGG - Intronic
945544924 2:211138578-211138600 CCCTGAAGGACAGCTGTGAAGGG + Intergenic
946199023 2:218060360-218060382 CCCTGAAGAAGAGCCAACAAAGG + Intronic
946209474 2:218135841-218135863 CCCTGAAGAAGAGCCAACAAAGG - Exonic
946300442 2:218820755-218820777 CCATGGTGGAGAGCTCTGAAGGG + Intergenic
946527808 2:220539537-220539559 CCCTGAAGGACAGCATTGAAGGG - Intergenic
946703704 2:222437357-222437379 CCCTGAAGGACAGCGGTGAAGGG - Intronic
948592425 2:239059919-239059941 GCCTGCAGGAGAGCTCTCCGGGG + Intronic
1171330006 20:24329205-24329227 CCCTGAAGGACAGCGGTGAAAGG - Intergenic
1173713615 20:45181665-45181687 CCCTGACTGAGAGCTTTCTAAGG + Intergenic
1177913241 21:27056645-27056667 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1179878828 21:44285113-44285135 CCCTGAGTGAGAGCTCCCAAAGG - Intergenic
1182055710 22:27353035-27353057 CCCTGAAGGAGAAAGCTGAACGG - Intergenic
1183005849 22:34901337-34901359 CTCTGGAGGAGAGCTCTAGATGG + Intergenic
1184080612 22:42217039-42217061 CCCTGAAGGGGAGCTGAAAATGG + Intronic
950118608 3:10467358-10467380 CCCTGGAGCGGGGCTCTCAAGGG - Intronic
950327519 3:12125679-12125701 GCCTGAAGAAGTGGTCTCAAGGG + Intronic
950809015 3:15633420-15633442 CCCGGTAGGAGAGCTCTAAGTGG - Intronic
951970704 3:28441455-28441477 CCCTGAAGGAGAGTTGTGAATGG - Intronic
952282109 3:31933772-31933794 CACTGAAGGACAGCAATCAAGGG + Intronic
952979561 3:38723734-38723756 CCCTGATGGAGTGCTGGCAATGG + Intronic
953977132 3:47390356-47390378 CCCTCACTGAGAGCTCTCCACGG + Intronic
954183160 3:48897619-48897641 CCCTGAAGTAGAGCTCATACTGG - Intronic
954873334 3:53784513-53784535 CTCTGCAGGAGAGAACTCAAGGG - Intronic
955501913 3:59593806-59593828 CCCTGAGGGGCAGCTCTGAAAGG + Intergenic
955782939 3:62505648-62505670 TCATGAAGGGAAGCTCTCAAAGG - Intronic
956360510 3:68441872-68441894 CCCTGAAGGACAGCAGTGAAGGG + Intronic
956475181 3:69611839-69611861 GGCAGAAGGAGAGCTCTCAATGG + Intergenic
958784381 3:98581654-98581676 TCCAGATGGAGAGCTCTCAATGG - Intronic
958934365 3:100241046-100241068 CCCTGAAGGATAGCAGTGAAGGG + Intergenic
959488920 3:106963437-106963459 CCATGAAGGAGAGATAACAAAGG - Intergenic
959698690 3:109277298-109277320 CCCTGAATTAGAGCACTAAAGGG + Intergenic
959950501 3:112175316-112175338 CCCTGGGGCAGAGCTCTCAGAGG - Intronic
959997923 3:112698754-112698776 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
960342201 3:116487156-116487178 CCCTGAGACAGAGCTCCCAACGG + Intronic
960344359 3:116514111-116514133 CACTGTAGTAGGGCTCTCAAGGG + Intronic
960349583 3:116576135-116576157 CCCTGAAGGACAGCCGTGAAGGG + Intronic
962373004 3:134836103-134836125 CCCTCATGGAGAGCTATCCATGG + Intronic
964143723 3:153433579-153433601 CCCTGCAGGAGAGCTCATATGGG - Intergenic
964458216 3:156892297-156892319 TTCTGAAGGAGAGGACTCAATGG + Intronic
964679176 3:159318480-159318502 CCCTGAAGGACAGCAGTGAAGGG - Intronic
964703969 3:159598577-159598599 CACAGAAGCAGAGCTCTCCAAGG - Intronic
965811229 3:172593109-172593131 CCCTGAGAGGGAGCTCTCAGAGG - Intergenic
967890333 3:194360183-194360205 CCCTGAAGGAGCTCTCTCCGGGG - Exonic
971817285 4:31505506-31505528 CCCTGAAGGACAGCTATGAAGGG + Intergenic
972201247 4:36716751-36716773 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
974478992 4:62420451-62420473 CCCTGAAGGACAGTGCTGAAGGG - Intergenic
974787189 4:66634174-66634196 CCATGATTGAGAGTTCTCAAGGG - Intergenic
976034150 4:80795388-80795410 CCCTGAAGGACAGCAGTGAAAGG - Intronic
976324881 4:83759893-83759915 CCCTGAATGTAATCTCTCAAGGG - Intergenic
977701679 4:100029446-100029468 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
977898770 4:102395022-102395044 CCCTGAAGGACAGCGGTGAAGGG + Intronic
977930347 4:102743385-102743407 CCCTGAAGGATAGCAGTGAAGGG - Intronic
978341524 4:107725115-107725137 CCCTGAAGGACAGCAATGAAGGG - Intergenic
978772097 4:112467354-112467376 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
979595678 4:122531745-122531767 CCCTGAAGGACAGCAATGAAAGG - Intergenic
980517161 4:133878122-133878144 CCCTGAGACAGAGCTCTCATAGG - Intergenic
980728864 4:136801982-136802004 TCCTGAAGTAGAACTCTCCAAGG - Intergenic
980957793 4:139446350-139446372 CCCTGAAGGACAGCAGTGAAAGG + Intergenic
981462871 4:145032227-145032249 CCCTGAAGGACAGCGGTGAAAGG + Intronic
981873600 4:149515633-149515655 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
982607939 4:157537893-157537915 CCCTCATGGAGAGCCCCCAATGG + Intergenic
983027457 4:162755724-162755746 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
985027185 4:185749393-185749415 CCCTGAAGGGTGACTCTCAATGG - Intronic
985345818 4:189002661-189002683 CCCTGGAGGTGGGCTCTCAAGGG + Intergenic
986513732 5:8538699-8538721 CCATGTAAAAGAGCTCTCAATGG + Intergenic
986959895 5:13199629-13199651 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
987468133 5:18296554-18296576 CCCTGAAGGACAGCATTGAAGGG - Intergenic
987472621 5:18351613-18351635 CCCTGAAGGAGAGTGGTGAAGGG + Intergenic
988169143 5:27632403-27632425 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
988233231 5:28506656-28506678 CCCTGAAGGACAGCGGTGAAGGG - Intergenic
988474797 5:31574536-31574558 ATGTGAAGGAGAGCTCTCAATGG + Intergenic
988562190 5:32291271-32291293 CCCTGAAGGACAGCAGTGAAGGG + Intronic
989307442 5:39974189-39974211 CCCTGAAGGACAGCGGTGAAAGG - Intergenic
991100495 5:62786918-62786940 TCCTCAAAGAGAGCCCTCAAAGG - Intergenic
993226326 5:85169900-85169922 CCCTGAGATAGAGCTCTCAGAGG - Intergenic
993367411 5:87050529-87050551 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
993791844 5:92219343-92219365 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
994191670 5:96875787-96875809 CCTTGAAGGAGGGATCACAATGG + Intronic
996791405 5:127297548-127297570 CCTTGAAGGAGAGATTTGAATGG + Intronic
996825624 5:127678274-127678296 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
996871631 5:128199204-128199226 CTCTGTAGGAGAGCTCTGACGGG - Intergenic
997948710 5:138224809-138224831 CCCTGCAGGGGAGCTCCCACTGG - Intergenic
1000417029 5:160994334-160994356 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1002176740 5:177404959-177404981 CCAGGAAGGAGAGCTCTCTGGGG - Intronic
1002409076 5:179060259-179060281 CCGCCAACGAGAGCTCTCAAAGG - Intergenic
1003327421 6:5102915-5102937 CCCAGAAGGAAAACTCTCAGAGG - Intronic
1003624842 6:7731301-7731323 ACCTGAAGGATACCTCTCCAAGG - Intronic
1004656424 6:17666437-17666459 CCCGGAGGCAGAGCTTTCAATGG + Intronic
1004873323 6:19929869-19929891 CCCTGAAGAAATACTCTCAAAGG + Intergenic
1006932094 6:37694753-37694775 GCCTGAAGCCAAGCTCTCAAAGG + Intronic
1007386402 6:41523142-41523164 CTCTGAAGGACAGCTCTCTCTGG + Intergenic
1007986090 6:46208194-46208216 GCCTGAATGAGAGCTATCTAGGG + Intergenic
1008820462 6:55625585-55625607 CCCTGAAGGACAGCAATGAAGGG + Intergenic
1009806551 6:68607380-68607402 CCCTGAAGGAGAGCAGCGAAGGG + Intergenic
1010107889 6:72190135-72190157 CCCTGAAGGACAGCAGTGAAGGG - Intronic
1010323637 6:74540922-74540944 CCCTGAAGGACAGTGCTGAAGGG + Intergenic
1010406928 6:75516432-75516454 CCCTGAAGGAGAGTGGTGAAGGG - Intergenic
1010569584 6:77462056-77462078 TCCTGAGAGAGAGCTCTGAAAGG - Intergenic
1011069165 6:83362096-83362118 CCCTGAAGGACAGCAGTGAAGGG + Intronic
1011684657 6:89814777-89814799 CCCTGGCGGAGATCTCCCAATGG - Intronic
1013121644 6:107146638-107146660 CCTTGCATCAGAGCTCTCAAAGG - Intergenic
1013816856 6:114109331-114109353 CCCTGAGGAAGAGTCCTCAATGG - Intronic
1014124138 6:117758345-117758367 CCCTGAGATAGAGCTCTCAGGGG + Intergenic
1014363343 6:120507919-120507941 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1014631700 6:123797234-123797256 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1015443227 6:133272130-133272152 CTCTGAAGGACAGCGCTGAAGGG - Intronic
1015466785 6:133557280-133557302 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1016144354 6:140649840-140649862 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1016147265 6:140692280-140692302 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1017902770 6:158732597-158732619 CCCTGCAGGTCAGCCCTCAAGGG + Intronic
1018788865 6:167130997-167131019 CCCAGAAGGAGGGGTCCCAAAGG - Intronic
1019140426 6:169938993-169939015 GCCTAAAGGTGAGGTCTCAAAGG + Intergenic
1021988876 7:26123358-26123380 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1022078949 7:27000764-27000786 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1024491775 7:49994194-49994216 CCCTGAAGGACAGTTGTGAAGGG - Intronic
1025027679 7:55531316-55531338 CCTTTAAGGAGAGCATTCAAAGG - Intronic
1026799431 7:73390055-73390077 CCCAGAAGGACACCTCTCAGTGG + Intergenic
1027685862 7:81278390-81278412 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1028237886 7:88383256-88383278 CCCTGAAGGACAGCAATGAAGGG + Intergenic
1028935078 7:96455498-96455520 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1030368814 7:108674462-108674484 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1031833063 7:126650447-126650469 CCCTGAAGGACAGCAGTGAAGGG + Intronic
1032153040 7:129446526-129446548 CCCTGAAGGACAGCAGTGAAGGG - Intronic
1032887412 7:136156055-136156077 CCATGAAGGATGGCCCTCAAAGG + Intergenic
1033470188 7:141640243-141640265 CCCTGAAGGAGCTGTTTCAATGG - Intronic
1033834120 7:145288249-145288271 ACCTGAAGGAGAGTTCTGAGAGG + Intergenic
1034412954 7:150950726-150950748 CCCAAAAGGGGAGCTCTCCAGGG + Intronic
1036587501 8:10137896-10137918 CCCTGAAGAAGAGACCGCAAAGG + Intronic
1037364525 8:18107827-18107849 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1041818583 8:62003062-62003084 AACCAAAGGAGAGCTCTCAAGGG + Intergenic
1044811564 8:96068923-96068945 CCCTTCAGGGGAGCTCTCCAAGG + Intergenic
1045221902 8:100207499-100207521 CCCTGAAGGACAGCAGTGAAGGG + Intronic
1046197617 8:110884655-110884677 CCCTGAAGGACAGCGGTGAAGGG + Intergenic
1047659136 8:127013482-127013504 GCCTGAAGGAGAGCTGACATAGG + Intergenic
1048261404 8:132948511-132948533 CCATGAAGGAAAGCTCTCATAGG + Intronic
1048558365 8:135505391-135505413 CCCTGAAGGAGAGCTCTCAAGGG - Intronic
1048853408 8:138665472-138665494 CCCTGAGGGTGAGTTCTCAGAGG - Intronic
1050825645 9:9941744-9941766 CTCTGAAGAAGAGGTCCCAAAGG + Intronic
1052368713 9:27641270-27641292 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1052737285 9:32355144-32355166 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1052895430 9:33743204-33743226 CCCTGAAAGACAGCTGTGAAGGG - Intergenic
1057231237 9:93322720-93322742 CCCTCATGGAGAGTTCTCATGGG + Intronic
1058259200 9:102809250-102809272 CCCTGAAGGACAGCACGGAAGGG - Intergenic
1058900384 9:109437487-109437509 CCAAGAAGGCCAGCTCTCAAGGG - Intronic
1059029783 9:110679168-110679190 GTCTGAAGGAGATCTCTTAAAGG + Intronic
1060453755 9:123769803-123769825 CCATGCAGGAAAGCTCTGAAGGG + Intronic
1061269094 9:129526415-129526437 CCCTGCAGATGAGCTCACAAAGG + Intergenic
1061774322 9:132950476-132950498 CCTTGAAGTAGAGGTTTCAAGGG - Intronic
1191922462 X:66271115-66271137 CCCTGACGCAGAGCTCCCAGAGG + Intergenic
1191932978 X:66394596-66394618 CCCTGAAGGACAGCAGTGAAGGG + Intergenic
1191946412 X:66539451-66539473 CCCTGAGGGACAGCTGTGAAGGG + Intergenic
1192639011 X:72845864-72845886 CCCTGCAGGGGAGCTCCCAAGGG + Exonic
1192642701 X:72874944-72874966 CCCTGCAGGGGAGCTCCCAAGGG - Exonic
1193297845 X:79853106-79853128 CCCTGAAGGAGAGTGGTGAAGGG + Intergenic
1193960982 X:87924499-87924521 CCCTGGGAGAGAGCTCCCAAGGG + Intergenic
1194485179 X:94477756-94477778 CCCTGAAGGACAGCAGTGAAAGG + Intergenic
1194594095 X:95836519-95836541 CCCTGGAACAGAGCTCTCAGAGG - Intergenic
1194849186 X:98851736-98851758 CCCTGAAGGACAGCGGTGAAGGG - Intergenic
1195809726 X:108816417-108816439 CCCTGAAGGATAGCAGTGAAGGG - Intergenic
1196557092 X:117100782-117100804 CCATGAATGAAAGCTCTCTAGGG + Intergenic
1196601167 X:117603295-117603317 CCCTGAGACAGAGCTCCCAATGG + Intergenic
1196819115 X:119688941-119688963 GCCTGAAGCAGAGACCTCAAAGG + Intronic
1197122263 X:122906491-122906513 CCCTGAAGTGGAGCTCCCAAGGG + Intergenic
1197182150 X:123548205-123548227 CCCTGAAGGACAGCAATGAAGGG + Intergenic
1197419941 X:126226763-126226785 CCCTGAAGGAGAGCGGTGAAGGG + Intergenic
1198701361 X:139400729-139400751 CCCTGAAGGATAGCGGTGAAGGG + Intergenic
1199024440 X:142920151-142920173 CCCTGAAGGAGAGCGGTGAAGGG + Intergenic
1199144394 X:144348542-144348564 CCCTGAAGGACAGCAGTGAAGGG - Intergenic
1199367673 X:147006310-147006332 CCCTGAAGGACAGTTGTAAAGGG + Intergenic