ID: 1048558366

View in Genome Browser
Species Human (GRCh38)
Location 8:135505391-135505413
Sequence CCCTTGAGAGCTCTCCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558360_1048558366 -1 Left 1048558360 8:135505369-135505391 CCCTGCTTGTGGTCCCTTGGGAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558356_1048558366 4 Left 1048558356 8:135505364-135505386 CCCTGCCCTGCTTGTGGTCCCTT 0: 1
1: 1
2: 3
3: 22
4: 295
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558351_1048558366 30 Left 1048558351 8:135505338-135505360 CCAAAACCTTGGCCTGTCTACCA 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558361_1048558366 -2 Left 1048558361 8:135505370-135505392 CCTGCTTGTGGTCCCTTGGGACC 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558354_1048558366 10 Left 1048558354 8:135505358-135505380 CCACTTCCCTGCCCTGCTTGTGG 0: 1
1: 1
2: 5
3: 71
4: 656
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558352_1048558366 24 Left 1048558352 8:135505344-135505366 CCTTGGCCTGTCTACCACTTCCC 0: 1
1: 1
2: 3
3: 23
4: 291
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558357_1048558366 3 Left 1048558357 8:135505365-135505387 CCTGCCCTGCTTGTGGTCCCTTG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data
1048558353_1048558366 18 Left 1048558353 8:135505350-135505372 CCTGTCTACCACTTCCCTGCCCT 0: 1
1: 0
2: 3
3: 43
4: 426
Right 1048558366 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558366 Original CRISPR CCCTTGAGAGCTCTCCTTCA GGG Intronic
No off target data available for this crispr