ID: 1048558367

View in Genome Browser
Species Human (GRCh38)
Location 8:135505392-135505414
Sequence GCCCTGAAGGAGAGCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558367_1048558369 -8 Left 1048558367 8:135505392-135505414 CCTTGAGAGCTCTCCTTCAGGGC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558367 Original CRISPR GCCCTGAAGGAGAGCTCTCA AGG (reversed) Intronic
901245840 1:7730351-7730373 GCCCTGAGGCAGGGCTTTCAGGG - Intronic
902363552 1:15955986-15956008 GCCCTGAAAAAGAGCTGTCCAGG + Intronic
904272797 1:29361694-29361716 TCCCTGAGGAAGAGCTCCCAAGG + Intergenic
904498639 1:30901660-30901682 GGCCTGAAGGAGAACTCTGGGGG - Intronic
904785930 1:32982972-32982994 GTCCTGAACTAGAACTCTCAGGG - Intergenic
905308085 1:37032912-37032934 GCCCTGAAGAAGAGCTGTAGAGG + Intronic
906453278 1:45971096-45971118 GAGCTGAAGGAGAGTTCTCAAGG + Intronic
907850541 1:58250640-58250662 GGCCTGAATGTGAGCTCTGAGGG + Intronic
910526176 1:88180931-88180953 GCCCTGAAGGAAAGAGCTCAAGG - Intergenic
911972158 1:104452467-104452489 CTGCTGAAGCAGAGCTCTCAAGG + Intergenic
912490421 1:110059736-110059758 GTCCTGCAGCAGAGCCCTCAAGG - Intronic
915864755 1:159487062-159487084 GCCCTGAAAGAGGGCACACATGG + Intergenic
918774551 1:188611209-188611231 TCCCTGAAGGAGAGCAGTAAAGG + Intergenic
918815134 1:189171681-189171703 TCCCTGAAGGACAGCTGTGAAGG + Intergenic
920718812 1:208367717-208367739 GCCCTGAAGATGAGCTCTGGAGG + Intergenic
922460671 1:225812417-225812439 GCCCTGAATGAGGGCTCTGTGGG + Intronic
1068150509 10:53124567-53124589 GGACTGAAAGAGAGCTCCCAAGG + Intergenic
1069359875 10:67630015-67630037 CCCCAGAGGCAGAGCTCTCATGG + Intronic
1069674043 10:70234209-70234231 CCCGTGAAGGAGTGTTCTCAGGG + Intergenic
1070338917 10:75479024-75479046 GCCTTGAAGGAGATCCCTGAAGG - Intronic
1071937747 10:90549737-90549759 TCCCTGAAGGAGAGCAATGAAGG + Intergenic
1073060885 10:100732874-100732896 ACCCTGAAGGAGAGGTATCAGGG - Intergenic
1074302074 10:112242038-112242060 GCCCTGAAGGAAAGGACACAAGG - Intergenic
1075606848 10:123817859-123817881 TCCCTGAAGGACAGCACTGAAGG + Intronic
1075973527 10:126674720-126674742 AGCCAGAAGGAGAGCTCTCATGG + Intergenic
1076329759 10:129655540-129655562 CCCTTGCAGGAGAGCTCTCGTGG + Intronic
1076794446 10:132791822-132791844 GCCCTGATGCAGAGATTTCAGGG + Intergenic
1078626379 11:12962537-12962559 GGCCTGCGCGAGAGCTCTCATGG + Intergenic
1084666344 11:70578414-70578436 GCACAGAAGGCGAGGTCTCAGGG + Intronic
1085829749 11:79886653-79886675 GGGCTGAATGAGAGCACTCATGG + Intergenic
1086983907 11:93227630-93227652 TCCCTCCAGGAGAACTCTCAAGG + Intergenic
1088552465 11:111026990-111027012 GCCTGGAAGGAGAGCTGTGATGG + Intergenic
1089004134 11:115076713-115076735 GACTTCAAGGAGTGCTCTCAGGG - Intergenic
1090413450 11:126524765-126524787 TCCCTGTAGGAGAGCTTTCGCGG + Intronic
1091207458 11:133831533-133831555 CCCCTGAGGGAGGGCTCTCTGGG - Intergenic
1091221375 11:133931641-133931663 GTCCTGAAGGTGAGGTCCCAGGG - Exonic
1094380973 12:29842256-29842278 GCTCAGTAGGAAAGCTCTCAGGG + Intergenic
1095782402 12:46074223-46074245 GGACTGAAGGAGAGCTAGCAGGG - Intergenic
1096288773 12:50323391-50323413 TCCCTGAAGGAGAGCAGTGAAGG + Intergenic
1096311353 12:50524092-50524114 GGCCTGAAGGAGAGGAATCAAGG - Intronic
1096457402 12:51799001-51799023 TCCCTGAAGGAGAGCACTGAAGG - Intronic
1100023481 12:90099360-90099382 GCTCTGAAGGAAAGGTGTCAAGG - Intergenic
1101692137 12:107092882-107092904 GCCCTGAAGGAGTGCATTCAGGG - Exonic
1107998022 13:45879906-45879928 GCCTTGAATCAGAGCTCTCCTGG + Intergenic
1108083798 13:46763558-46763580 GCCCTCAAGAAGTGCTCTCCAGG - Intergenic
1108274223 13:48791489-48791511 ACCCTGAAGGAGAACTGTAAGGG + Intergenic
1108506668 13:51118558-51118580 GCCCTGATGGGGGGCTTTCAAGG + Intergenic
1110657206 13:78014315-78014337 GCCCTGAAGGAGAGACCACATGG + Intergenic
1111717252 13:91895131-91895153 GCATGGAAGCAGAGCTCTCAAGG + Intronic
1115863979 14:37722422-37722444 GCCCTGAAGGTCTGCTCTCAAGG - Intronic
1115896322 14:38092373-38092395 GGCATGAATGAGAGCGCTCAAGG + Intergenic
1118667038 14:68081630-68081652 ACACTGAATGAGAGCTCTGAAGG + Intronic
1118819938 14:69338644-69338666 ACCCTGAAGGAGAGCTCTGCAGG - Exonic
1119446606 14:74669878-74669900 GCCCAGGAGGAGAGATTTCAGGG + Intronic
1121095526 14:91215685-91215707 GCCTTGAAGCAGAGGTCTCCTGG + Intronic
1121379435 14:93450032-93450054 CTCCTGAAGAGGAGCTCTCAAGG - Intronic
1124088246 15:26572389-26572411 GGGATGAAGGAGAGCTTTCAAGG + Intronic
1127331010 15:57940175-57940197 TCCCTGAGACAGAGCTCTCAGGG - Intergenic
1128199849 15:65795122-65795144 GCCCTGTAGCATAGCTATCAAGG - Intronic
1129575348 15:76737309-76737331 GCCCTGATGGAGAGAGCACAAGG - Intronic
1129681201 15:77659408-77659430 ACCCTCAAGCAGAGGTCTCAAGG + Intronic
1131226587 15:90629093-90629115 TCCCTGTAGGAGAGCTGTCCAGG + Intronic
1131322430 15:91407413-91407435 TCATTGAAGGAGTGCTCTCAGGG + Intergenic
1132861616 16:2074540-2074562 GCCAGGAAGGAGAGCACTCATGG - Intronic
1133136190 16:3713825-3713847 GCTCTGACGAAAAGCTCTCATGG + Intronic
1134187753 16:12097959-12097981 GCCCTGGAGGAGAGCACCCCAGG + Intronic
1138080941 16:54090931-54090953 GCCCTGCTGGAGAGCCCACATGG - Intronic
1140852539 16:78948547-78948569 GGCATGAAGCAGAGCTGTCATGG - Intronic
1141124337 16:81389675-81389697 GCCATGAAAGAGAACTATCAAGG + Exonic
1143012170 17:3872130-3872152 GCTCTGGAGGAGAGCGGTCAGGG - Intronic
1145936985 17:28720120-28720142 GCCCCGGAGCAGAGCCCTCAGGG - Intronic
1146836416 17:36114421-36114443 TCCCTGAAGGAGAGCAGTGAAGG + Intergenic
1147341005 17:39753365-39753387 GCCCTGGAGGACAGGACTCAGGG - Intergenic
1149081797 17:52666659-52666681 GCTTTGAAGGAGAGGCCTCATGG - Intergenic
1152928205 17:83097567-83097589 GTCCTGCAGGAGAGAGCTCAGGG - Intergenic
1153642958 18:7171573-7171595 GCCCTGCAGGACACCTCTCCTGG + Intergenic
1154375762 18:13808449-13808471 GCCCTCCAGGTGAGCTCCCAGGG + Intergenic
1155917840 18:31573452-31573474 GTCCTGAAGAAAAGCTCTCGAGG - Intergenic
1158271954 18:55726103-55726125 GCCCTGAAGGGTATCTCCCAAGG - Intergenic
1158544771 18:58386706-58386728 GCACTGAGGCAGAGCTCTCGTGG + Intronic
1161512029 19:4677266-4677288 GCCACGAAGGAGGGCTCTCGAGG + Intronic
1161995010 19:7706731-7706753 GACCCTAAGGGGAGCTCTCATGG - Intergenic
1162495722 19:11022322-11022344 GCCCTGAGGGTGAGTTCTGAGGG - Intronic
1163126829 19:15248800-15248822 ACACTGAACGAGAGCTCTCCTGG + Intronic
926826824 2:16914100-16914122 TCCCTGAAGGACAGCACTGAAGG + Intergenic
928088886 2:28362071-28362093 TCCCTGAAGGAACCCTCTCATGG + Intergenic
928353743 2:30588225-30588247 GTCCTGAAGGAGATCCCTCCTGG + Intronic
930141341 2:47954107-47954129 GGCCTGGAGGAGGGTTCTCAGGG - Intergenic
931320083 2:61167522-61167544 CTCCTGGAGGAAAGCTCTCATGG - Intergenic
931511007 2:62994201-62994223 GCCCTGATGGAAATGTCTCAAGG - Intronic
932809879 2:74816190-74816212 GCCTTGATGGACAGCTCTAAGGG - Intergenic
933180948 2:79226948-79226970 GCTCAGATGGAGAGCTCTGAGGG + Intronic
935965931 2:108475813-108475835 TCCTTGAATGAGATCTCTCATGG - Exonic
939048123 2:137273854-137273876 GCCCAGCAAAAGAGCTCTCAAGG + Intronic
940153514 2:150628917-150628939 GCCCTATAGGAGAGCACTGATGG + Intergenic
940880851 2:158945349-158945371 GCACTGAAGCAGAGATTTCAGGG + Intergenic
941345351 2:164361794-164361816 GACCTGAAGGAGAGCACTCCAGG - Intergenic
942154963 2:173119120-173119142 GCACTGAGGGAGAGCACTTAAGG + Intronic
945544922 2:211138577-211138599 TCCCTGAAGGACAGCTGTGAAGG + Intergenic
945740167 2:213650046-213650068 GTTCTCAAGGAGAACTCTCAAGG + Intronic
947535955 2:230940602-230940624 GCCCTGTTTGTGAGCTCTCAGGG + Intronic
948592424 2:239059918-239059940 AGCCTGCAGGAGAGCTCTCCGGG + Intronic
948929734 2:241124314-241124336 GGCCTGGAGGAAAGCTGTCAGGG + Intronic
1173542181 20:43862362-43862384 TCCCTGAAGGAGATTTCTCCAGG + Intergenic
1173636875 20:44567346-44567368 TCCTTGAAGGAGGGCTCTCCTGG + Intronic
1174357886 20:50010272-50010294 GCCCTGAAGGCGTCCTCCCAGGG - Intergenic
1176021401 20:62964106-62964128 GCCCTGCCGGAGAGCTTTCCTGG + Intronic
1180017652 21:45097748-45097770 GCACTCAAGGGGAGCTGTCAGGG + Intronic
1181532101 22:23522697-23522719 GGCCTGAAGGTGAGCTCCCGGGG - Intergenic
1181599598 22:23941656-23941678 GCTCTGGAGGACAGCTCTCGTGG + Intergenic
1181608909 22:23999650-23999672 GCTCTGGAGGACAGCTCTCGTGG - Intergenic
1182999895 22:34847316-34847338 GACGTGAAGAAGAGCTTTCAGGG - Intergenic
1183526714 22:38327483-38327505 GCCCTGAGGGAGGGCTGTTAGGG - Intronic
949988180 3:9555649-9555671 TCCCTGCCGGTGAGCTCTCATGG + Intergenic
950117415 3:10460316-10460338 GCCCTTGAGGACAGCTCCCAGGG - Intronic
950574079 3:13820748-13820770 TCCTGGAAGGAGAGCTCTTAGGG - Intronic
952282108 3:31933771-31933793 GCACTGAAGGACAGCAATCAAGG + Intronic
952521918 3:34169456-34169478 TTCCTGAGGGAGGGCTCTCATGG + Intergenic
953820778 3:46205840-46205862 GCAGTGAAGGAGTTCTCTCAGGG - Intronic
954782527 3:53071983-53072005 GCCCTAAAGGAGGGTTGTCATGG + Intronic
954873335 3:53784514-53784536 GCTCTGCAGGAGAGAACTCAAGG - Intronic
956900126 3:73706979-73707001 GCCCTATAGAAGAGCTCACATGG - Intergenic
957569800 3:81931894-81931916 GACAAGAAGGAGAGTTCTCAGGG + Intergenic
958616128 3:96494861-96494883 GCCAAGAGGAAGAGCTCTCATGG - Intergenic
958757805 3:98271508-98271530 GCCCTGAAGGGTAAGTCTCAGGG - Intergenic
959118422 3:102205645-102205667 GCCCTGAAGGAAAGTACACAAGG - Intronic
959698688 3:109277297-109277319 GCCCTGAATTAGAGCACTAAAGG + Intergenic
964143725 3:153433580-153433602 GCCCTGCAGGAGAGCTCATATGG - Intergenic
966619945 3:181952871-181952893 GCCCTCTCAGAGAGCTCTCAGGG - Intergenic
967890335 3:194360184-194360206 TCCCTGAAGGAGCTCTCTCCGGG - Exonic
968547590 4:1206714-1206736 CCCCTGAGGGAGACCTCACAGGG - Intronic
971100957 4:23465989-23466011 TCCCTGAAGGACAGCTGTGAAGG - Intergenic
971817283 4:31505505-31505527 TCCCTGAAGGACAGCTATGAAGG + Intergenic
974644556 4:64674335-64674357 TCCCTGAAGGAGAGCAGTGAAGG - Intergenic
976212039 4:82681191-82681213 GACCTGAAGGAAAGCTCTGGTGG + Intronic
976324883 4:83759894-83759916 GCCCTGAATGTAATCTCTCAAGG - Intergenic
976718750 4:88150330-88150352 GCCCTCAAGCAGAGCTCTGAGGG + Intronic
981354994 4:143779220-143779242 GCCCTAAAGAAGAGAACTCAAGG - Intergenic
985345816 4:189002660-189002682 GCCCTGGAGGTGGGCTCTCAAGG + Intergenic
985947819 5:3200518-3200540 GCTTTGAGGGAAAGCTCTCAGGG - Intergenic
986916057 5:12622753-12622775 GCATGGAAGGAGAGCTGTCATGG - Intergenic
987160809 5:15140230-15140252 CTCCTGAAGGAGAAGTCTCAGGG - Intergenic
990830611 5:59952744-59952766 ACCCTCAAGGAGAGAACTCATGG + Intronic
992215157 5:74518530-74518552 GGCCTGAAGGAGTGCTTTCCGGG - Intergenic
994291308 5:98031518-98031540 CCCCTGAAGGACAGCTGTGAAGG - Intergenic
994749235 5:103718236-103718258 GCCCTCATGGAGACCTCTAATGG + Intergenic
996871632 5:128199205-128199227 ACTCTGTAGGAGAGCTCTGACGG - Intergenic
997232413 5:132254430-132254452 GCCTTGAAGGAGAGATGTCTTGG + Intronic
1000872967 5:166600167-166600189 TCCCTGAAGAAGAGCTCTTTGGG - Intergenic
1002176742 5:177404960-177404982 GCCAGGAAGGAGAGCTCTCTGGG - Intronic
1006436049 6:34026704-34026726 GCCCTCACAGAGAGCTCTGATGG - Intronic
1006896877 6:37476965-37476987 GTCCTGAAAGACAGCTCCCAGGG + Intronic
1007986089 6:46208193-46208215 GGCCTGAATGAGAGCTATCTAGG + Intergenic
1010610762 6:77951870-77951892 GCCCTGAATGACAGCTGTAAAGG - Intergenic
1014124136 6:117758344-117758366 TCCCTGAGATAGAGCTCTCAGGG + Intergenic
1017764221 6:157593575-157593597 CCCCTGGAGGAGAGGTCTCCCGG - Intronic
1020740520 7:12010522-12010544 GCCCTGAATGAGAGATTTCATGG + Intergenic
1024114282 7:46177701-46177723 GTCATGAAGGAGAGACCTCATGG + Intergenic
1024313554 7:47992059-47992081 GCACTGCAGGAGTCCTCTCAGGG + Intronic
1029226772 7:99034183-99034205 GCCCTGCAGGAGGTCTCTGAAGG - Intronic
1029714243 7:102317434-102317456 GCCCTGAGGGAGAGGGGTCATGG + Intronic
1038660636 8:29493716-29493738 GCTCTAGAGGAGAGCTGTCAGGG - Intergenic
1038887255 8:31676931-31676953 TCCCTGAATGGGAGCTTTCATGG + Intronic
1042420869 8:68587443-68587465 GACCTCAAGTGGAGCTCTCAGGG + Intronic
1042509496 8:69596681-69596703 GCACTGATGGAGAGCTATCCCGG + Intronic
1043648384 8:82553994-82554016 GACCTGAAGGAGTAGTCTCAGGG - Intergenic
1044919162 8:97149515-97149537 GACCTGGAGGTGAGCTCTGACGG + Intronic
1045360921 8:101432557-101432579 GCCCTTAGAGAGAGCTCTGATGG - Intergenic
1047713477 8:127574788-127574810 TCACTGAAGGAGGGATCTCAGGG + Intergenic
1047994756 8:130323810-130323832 GCCCTCAAGGATGTCTCTCAAGG - Intronic
1048291540 8:133185207-133185229 GTCCTGCAGCAGATCTCTCAGGG - Intergenic
1048558367 8:135505392-135505414 GCCCTGAAGGAGAGCTCTCAAGG - Intronic
1051742742 9:20267373-20267395 GACCTGAAGGTGAGTTTTCAGGG - Intergenic
1053372331 9:37573285-37573307 GCCCTAAAAGAGAACTCTCCAGG + Intronic
1055958152 9:81793692-81793714 GGTCTGAAGGACAACTCTCAGGG - Intergenic
1057231235 9:93322719-93322741 CCCCTCATGGAGAGTTCTCATGG + Intronic
1057583610 9:96309613-96309635 CCCCTGGAGGAGAGCGCTAAGGG + Intergenic
1058456235 9:105140684-105140706 GCCCAGAGGGAGATATCTCAGGG + Intergenic
1058736616 9:107899810-107899832 GGTCGGAAGGAGAGCTCACAGGG - Intergenic
1060453753 9:123769802-123769824 GCCATGCAGGAAAGCTCTGAAGG + Intronic
1060816133 9:126636239-126636261 GCCCTGATGGAGAGAACACAGGG + Intronic
1061248437 9:129413407-129413429 GGCCTGAAGGTGAGCTCCCGGGG + Intergenic
1187833700 X:23409053-23409075 GACCTGAAGAAGAGGCCTCAAGG + Intergenic
1192639009 X:72845863-72845885 CCCCTGCAGGGGAGCTCCCAAGG + Exonic
1192642703 X:72874945-72874967 CCCCTGCAGGGGAGCTCCCAAGG - Exonic
1192858422 X:75039473-75039495 GCCCTGAAGGAAAGGACACAAGG - Intergenic
1194418307 X:93640166-93640188 TCCCTGGAGCAAAGCTCTCAGGG + Intergenic
1197122261 X:122906490-122906512 TCCCTGAAGTGGAGCTCCCAAGG + Intergenic
1197419939 X:126226762-126226784 TCCCTGAAGGAGAGCGGTGAAGG + Intergenic
1197613123 X:128660808-128660830 CTCCTGAAGGAGAAGTCTCAGGG + Intergenic
1199024438 X:142920150-142920172 TCCCTGAAGGAGAGCGGTGAAGG + Intergenic