ID: 1048558369

View in Genome Browser
Species Human (GRCh38)
Location 8:135505407-135505429
Sequence TTCAGGGCTAGCGTAGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558360_1048558369 15 Left 1048558360 8:135505369-135505391 CCCTGCTTGTGGTCCCTTGGGAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558367_1048558369 -8 Left 1048558367 8:135505392-135505414 CCTTGAGAGCTCTCCTTCAGGGC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558365_1048558369 -7 Left 1048558365 8:135505391-135505413 CCCTTGAGAGCTCTCCTTCAGGG 0: 1
1: 0
2: 1
3: 28
4: 274
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558361_1048558369 14 Left 1048558361 8:135505370-135505392 CCTGCTTGTGGTCCCTTGGGACC 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558363_1048558369 1 Left 1048558363 8:135505383-135505405 CCTTGGGACCCTTGAGAGCTCTC 0: 1
1: 0
2: 3
3: 17
4: 163
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558354_1048558369 26 Left 1048558354 8:135505358-135505380 CCACTTCCCTGCCCTGCTTGTGG 0: 1
1: 1
2: 5
3: 71
4: 656
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558357_1048558369 19 Left 1048558357 8:135505365-135505387 CCTGCCCTGCTTGTGGTCCCTTG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558362_1048558369 2 Left 1048558362 8:135505382-135505404 CCCTTGGGACCCTTGAGAGCTCT 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data
1048558356_1048558369 20 Left 1048558356 8:135505364-135505386 CCCTGCCCTGCTTGTGGTCCCTT 0: 1
1: 1
2: 3
3: 22
4: 295
Right 1048558369 8:135505407-135505429 TTCAGGGCTAGCGTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558369 Original CRISPR TTCAGGGCTAGCGTAGTCTC TGG Intronic
No off target data available for this crispr