ID: 1048558914

View in Genome Browser
Species Human (GRCh38)
Location 8:135511391-135511413
Sequence AAGAATAATAATGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1200
Summary {0: 1, 1: 0, 2: 8, 3: 112, 4: 1079}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048558914_1048558918 7 Left 1048558914 8:135511391-135511413 CCATCCTCCTCATTATTATTCTT 0: 1
1: 0
2: 8
3: 112
4: 1079
Right 1048558918 8:135511421-135511443 TTTCCTCCTGTCTTCCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048558914 Original CRISPR AAGAATAATAATGAGGAGGA TGG (reversed) Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901501817 1:9657267-9657289 AAAAATAATAATGTGGAAAATGG - Intronic
901737121 1:11319675-11319697 AAGAGGAAAAATGAGGGGGATGG + Intergenic
901787621 1:11635230-11635252 AATAAGAATAAAGAGGAGGCCGG + Intergenic
901835547 1:11921844-11921866 AAAAATAATAATAATGAGGCTGG - Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
904111066 1:28126523-28126545 AGGCAGAATAATGTGGAGGAAGG - Intergenic
904231025 1:29072665-29072687 AAGAATGATTAAGAGGAGAATGG + Intronic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904649272 1:31992247-31992269 AAAAAAAAGAATGAGTAGGAGGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905575798 1:39043701-39043723 AAGAAAAAGAAAGAAGAGGAAGG + Intergenic
905752880 1:40481267-40481289 AAGACTAATAATGTGGTGGGTGG + Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906439382 1:45827642-45827664 AAAAATAATGATGATGATGATGG - Intronic
906462337 1:46044480-46044502 AAGAATAATAAAAAGAAGGAAGG - Intronic
906559071 1:46741309-46741331 AAGAAGAAAAATAGGGAGGAAGG - Intergenic
906655542 1:47545774-47545796 AAGAAAGAAAAGGAGGAGGAGGG - Intergenic
907572255 1:55494044-55494066 AATAATAATAATAAAGAGGTAGG - Intergenic
907611638 1:55877029-55877051 AAGAATAAACATGTGTAGGAAGG - Intergenic
907812544 1:57885947-57885969 AAGAATAAGATTAAGCAGGAGGG - Intronic
908279323 1:62514647-62514669 AATAATAATAATAATGATGATGG + Intronic
908406452 1:63818711-63818733 AATAATTATAATGAGGCTGATGG + Intronic
909055606 1:70817235-70817257 AAAAAAAAAAAGGAGGAGGAAGG + Intergenic
909167090 1:72240801-72240823 GAGAATAATGATCAGGAGCATGG - Intronic
909457246 1:75863812-75863834 AAAAATAATAATAAACAGGAAGG - Intronic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
910655573 1:89614897-89614919 AAGAATAATAATGCAGAGAAAGG - Intergenic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911209592 1:95125513-95125535 AAGACTAGTCAAGAGGAGGAGGG + Intronic
911228648 1:95335765-95335787 AAGAATAATATTGATAATGATGG + Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912147760 1:106814967-106814989 AAGAAATATAATGATGAAGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912558720 1:110535023-110535045 AAGAATAATAATGATGATGGTGG - Intergenic
912796597 1:112697157-112697179 AAGAAAAATAGGGAGGAGGTCGG + Intronic
912838596 1:113018993-113019015 AAACAGAATAATGAGGAGAAAGG + Intergenic
912916931 1:113824879-113824901 AAGAATAATAATTAGTACAATGG - Intronic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913136619 1:115896671-115896693 AGGAGTAAGAATGAGGAAGATGG - Intergenic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
913360160 1:117971620-117971642 ATGAATAATGATGACTAGGAGGG + Intronic
913647111 1:120868742-120868764 AAGAAAAACATTGAGGAGAAAGG + Intergenic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914079531 1:144394123-144394145 AAGAAAAACATTGAGGAGAAAGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914174429 1:145262666-145262688 AAGAAAAACATTGAGGAGAAAGG - Intergenic
914529101 1:148503842-148503864 AAGAAAAACATTGAGGAGAAAGG - Intergenic
914699338 1:150117219-150117241 AATAATAATAATAAGTAGGGGGG + Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915211450 1:154312724-154312746 AAGAATAAAAATGATGAAGTAGG - Intergenic
915212564 1:154321418-154321440 AAGAATAAAAATGATGAAGTAGG - Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
916007313 1:160674354-160674376 AAAAAAAATAATCAGCAGGATGG + Intergenic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916757908 1:167790746-167790768 AAAAATAATAATGAGCTTGATGG - Exonic
917218574 1:172703506-172703528 ATGAAGAATAAAGTGGAGGATGG + Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917476218 1:175371558-175371580 AAGAATAATGACGAAGGGGAGGG + Intronic
917799715 1:178559750-178559772 CACACTGATAATGAGGAGGAAGG - Intergenic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918231123 1:182533207-182533229 CAGAAAAATAATTAGGAGGTAGG - Intronic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918604048 1:186400284-186400306 AATAATAAGAATGGGGAGGCCGG - Intronic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
918882404 1:190141856-190141878 AGGAAAAATAATGAGGATTAAGG - Intronic
918951147 1:191140608-191140630 AAGAATTAAAATGAGCAGCAGGG - Intergenic
918952410 1:191155938-191155960 TAAAAAATTAATGAGGAGGACGG - Intergenic
919248530 1:195020896-195020918 GAGTATGATAATGAGCAGGATGG - Intergenic
919846123 1:201643291-201643313 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
920035409 1:203061915-203061937 AAGAATGAGACTGAGGAGAAGGG - Intronic
920217277 1:204369776-204369798 TAGGATGATAATGAGGTGGAAGG + Intronic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920736425 1:208537055-208537077 AATAAGAATAATGGGGAGAAAGG - Intergenic
921259887 1:213376904-213376926 GAGAAGAAGAATGAGGTGGAGGG + Intergenic
921569899 1:216765292-216765314 AACAATAATAATGATGATAATGG + Intronic
921644744 1:217600677-217600699 AATAATAATAATGGGGACTATGG + Intronic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
922298282 1:224271615-224271637 AAGAGTAATACGGAGGAGAATGG + Intronic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922990658 1:229908240-229908262 AAAAATGAGAATGAGGGGGACGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923266188 1:232316382-232316404 AAGAAGAATAATGAGAATAAAGG + Intergenic
923466851 1:234256016-234256038 GATATTAATAATGGGGAGGAGGG + Intronic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923666497 1:236002917-236002939 GGGAGGAATAATGAGGAGGAGGG - Intronic
923811776 1:237325975-237325997 ACACATAATAATGAGAAGGATGG + Intronic
924045340 1:240024001-240024023 AAAATTAAGAATGAGAAGGATGG + Intronic
924274531 1:242372162-242372184 AATAATAATGATGAAGAGAAGGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063547661 10:6998137-6998159 AAGAATGATTAGGAGGAGCATGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064173803 10:13056828-13056850 AACAAAAATTGTGAGGAGGAAGG + Intronic
1065409372 10:25406866-25406888 AAGATCAACAATGAAGAGGAAGG + Intronic
1066114705 10:32229508-32229530 AATAATAATAATAATGAAGATGG - Intergenic
1066114924 10:32231063-32231085 AATAATAATGATGATGAAGATGG - Intergenic
1066119140 10:32267046-32267068 AAGGATAATAAGGCCGAGGATGG - Intergenic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066668538 10:37812250-37812272 AAGAAAATCATTGAGGAGGAAGG + Intronic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1067515114 10:46933123-46933145 AGCAATAATAATGACAAGGAGGG - Intronic
1067647142 10:48118687-48118709 AGCAATAATAATGACAAGGAGGG + Intergenic
1067845266 10:49714937-49714959 AAAAATAATAATAAAGAAGATGG + Intergenic
1068520589 10:58073125-58073147 AATAATAATAATTAGGAGGGAGG - Intergenic
1068520590 10:58073128-58073150 AATAATAATAATAATTAGGAGGG - Intergenic
1068809007 10:61234773-61234795 AAGAGAAATAGTGGGGAGGAAGG - Intergenic
1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG + Intergenic
1069195299 10:65544124-65544146 AAGAATAAGAAGGAGGGAGAGGG - Intergenic
1069433000 10:68354119-68354141 ATTAATAATAATGATGATGATGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070575120 10:77671827-77671849 AAGAATAATACTGACATGGAAGG - Intergenic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071156050 10:82690966-82690988 AAGAAGGAGAAAGAGGAGGAAGG - Intronic
1071366132 10:84902283-84902305 AATAATAATAAAGTGGAGGTAGG + Intergenic
1071472379 10:85992791-85992813 AATAATAATAATAATGAGCAGGG + Intronic
1071821001 10:89280749-89280771 TGGAATAATAACGAGGAAGAAGG - Intronic
1072785607 10:98278300-98278322 AAGTATAAAGATGAGAAGGAAGG + Intergenic
1073294950 10:102433274-102433296 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073438988 10:103541305-103541327 AAGAAAAATAAGGAGGAAGCTGG + Intronic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1074394129 10:113083363-113083385 AAAAATAATAATGAGAAAAAAGG + Intronic
1074802714 10:117017595-117017617 TAGAAAATTAATGAGGAAGAAGG + Intronic
1074852515 10:117450071-117450093 AATAATAATGATGAAAAGGATGG + Intergenic
1074879481 10:117643410-117643432 AAGAATACAAATGAGGAGCCAGG - Intergenic
1074945862 10:118280010-118280032 AAGGAGAATAAGGAGGTGGAAGG - Intergenic
1075844122 10:125531352-125531374 AATAATGGTTATGAGGAGGATGG - Intergenic
1076416243 10:130291507-130291529 CACACTAATGATGAGGAGGAAGG + Intergenic
1076531332 10:131147333-131147355 AAGAAAATTAATGAGAGGGAAGG + Intronic
1078108207 11:8371865-8371887 AGGAAAAATAAAGAGAAGGAGGG - Intergenic
1078486535 11:11728311-11728333 AAGAATAATTTTGAGGAGCAAGG - Intergenic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1078634899 11:13040300-13040322 AAGAAAAAGAATGAGAGGGATGG - Intergenic
1078806180 11:14707360-14707382 AAGACTAATAAAGTAGAGGAGGG + Intronic
1079119980 11:17675068-17675090 AAGAATGATAATAACAAGGACGG - Intergenic
1079345418 11:19647478-19647500 CAGAGTTATAATGAGGATGAGGG - Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079519290 11:21306451-21306473 AAGTATAATAATAATGATGATGG + Intronic
1080423339 11:32132949-32132971 ATGAATAACAATGAGTAGAATGG - Intergenic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1080982161 11:37421544-37421566 AATAATTGTAATTAGGAGGAAGG + Intergenic
1082200737 11:49363614-49363636 CAGAAAAATAATGAGGAGTAAGG - Intergenic
1082301248 11:50509145-50509167 CACACTAATGATGAGGAGGACGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082737827 11:56875935-56875957 AAAGGTGATAATGAGGAGGAAGG + Intergenic
1082745451 11:56956237-56956259 AAGAATAAAAGGGAGGAAGAAGG + Intergenic
1082913276 11:58401856-58401878 AAGAACAAAAAGGTGGAGGAAGG - Intergenic
1082961372 11:58921527-58921549 GAGAATAATAACGTGGAGAATGG - Intronic
1083449561 11:62734000-62734022 AATAATAATAATGAGGGGGCTGG + Intronic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1085957892 11:81422444-81422466 AATAATAATGATGATGATGATGG - Intergenic
1086165424 11:83772432-83772454 AAGAAAAAAAAAGAGAAGGAGGG + Intronic
1086253278 11:84843489-84843511 AGGAATAATGATGATGATGATGG - Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086474258 11:87153575-87153597 ATGAATAACAATGAGGTAGAAGG - Intronic
1086477792 11:87198173-87198195 AAGAATAGAACTGAGGAGGATGG - Intronic
1086699856 11:89888908-89888930 AAAAATTATAAAGGGGAGGAAGG - Intergenic
1086706314 11:89955608-89955630 AAAAATTATAAAGGGGAGGAAGG + Intergenic
1086740235 11:90358717-90358739 AAGAAAAAGTATGAGCAGGAGGG - Intergenic
1087002165 11:93432185-93432207 AAGTTTGATAATGAAGAGGATGG + Intronic
1087172648 11:95066858-95066880 TAGAATAATAGGGAGGAGCATGG + Intergenic
1087186111 11:95197660-95197682 AAGAATAATATTTATAAGGAAGG - Intronic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1087260216 11:96002668-96002690 AAGAATAATGATGGGGATGGTGG + Intronic
1087288673 11:96296342-96296364 AAGAATAAAAATAAGAAGGGAGG + Intronic
1087687376 11:101280422-101280444 AAGAAAAATAATGACCAAGAGGG - Intergenic
1087814877 11:102647697-102647719 AACAATAATAATGAAGATGATGG - Intergenic
1088070140 11:105773108-105773130 AAGAATGAGAAGGAGGAGTAGGG - Intronic
1088559104 11:111094805-111094827 AAGAATAAGAATCAGAATGATGG - Intergenic
1089067297 11:115671428-115671450 ATGAAGAAAAATGAGGAAGAGGG - Intergenic
1089611985 11:119674357-119674379 ATTAATAATAATGATGATGATGG + Intronic
1090472388 11:126991463-126991485 AATAATAATAATAAAAAGGAAGG - Intronic
1090488443 11:127136085-127136107 AATAATAATAATGCTGACGATGG + Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1091133557 11:133167229-133167251 AATAATAATGATGATGATGAGGG - Intronic
1092513134 12:9179195-9179217 AAGAATAATTATCAGAAGGAAGG - Intronic
1092694775 12:11158986-11159008 AATAAAAAAAAGGAGGAGGAAGG + Intronic
1092795091 12:12103009-12103031 AAGAATAATAGTATGGAGGGTGG + Intronic
1092990714 12:13896234-13896256 ATGAGTAATAGTGAGGAAGATGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093161428 12:15751753-15751775 AAGAAGGATACTAAGGAGGAGGG - Intronic
1093324113 12:17752386-17752408 CAGAAGGATAATGGGGAGGAAGG - Intergenic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1093594554 12:20945283-20945305 AAAAACCATAATGAGGGGGAAGG - Intergenic
1093602524 12:21046279-21046301 AAGAAGGATAAGGAGGAGGAGGG - Intronic
1093771814 12:23026869-23026891 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1094054979 12:26259720-26259742 TAGACTAATAAAGAGGAAGAAGG + Intronic
1094061198 12:26316763-26316785 AAAAATAACAGTGAGGAGGAGGG - Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094224725 12:28032215-28032237 AAGAATGATATTGAGAATGAGGG - Intergenic
1094232414 12:28122327-28122349 AAGCAGAAGAATGAGGAGGGGGG + Intergenic
1094347123 12:29483090-29483112 AAGAAGACTGAAGAGGAGGAGGG - Intronic
1094408867 12:30148517-30148539 AATTATAATAATGAGTAGTAAGG + Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095142132 12:38677015-38677037 AGGAATTATAATGAGCAGGATGG + Intronic
1095242307 12:39875599-39875621 AACAGTTATAATGAGAAGGAAGG + Intronic
1095493593 12:42761553-42761575 CAGAATAATGATGAGTAGGTTGG - Intergenic
1096001739 12:48135874-48135896 AATAATAATAATAATGAGGAGGG - Intronic
1096208460 12:49742973-49742995 AAAAAAAAAAAAGAGGAGGAAGG - Intronic
1096517222 12:52163692-52163714 AAGAAGAGTATTGTGGAGGAAGG + Intergenic
1097113173 12:56677643-56677665 AATAATAATAATGGGGAACAAGG - Intronic
1097480124 12:60113590-60113612 AAGAAAAATAAAGAGGTGTAAGG - Intergenic
1097581249 12:61459480-61459502 AAGTATAATAATAAAAAGGAAGG + Intergenic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098578865 12:72075277-72075299 GAGAATTTTAATCAGGAGGAAGG + Intronic
1098665511 12:73157689-73157711 AAGAAAAATGAAGAGGAGAAAGG - Intergenic
1098684532 12:73401606-73401628 GAGAACAAAAATGTGGAGGAAGG + Intergenic
1098793287 12:74855854-74855876 ATTAATAATGATGAGGAGCATGG - Intergenic
1099050245 12:77773658-77773680 AAGAATGCTATTGAGGAGTATGG + Intergenic
1099061575 12:77917339-77917361 TAAAATAATAATGAAGAGAAGGG - Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099095195 12:78366886-78366908 AAGAATAATAGGGCAGAGGATGG + Intergenic
1099208632 12:79757756-79757778 AAAAATAACAATAATGAGGATGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099571127 12:84320247-84320269 AAGAAACATAAAAAGGAGGATGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099867713 12:88304541-88304563 AAAAAAAAAAAGGAGGAGGAAGG + Intergenic
1099870555 12:88343809-88343831 AATAATAATGATGATGATGATGG + Intergenic
1100347554 12:93747443-93747465 AAGAAGAAAAATTAAGAGGAAGG - Intronic
1100348724 12:93757746-93757768 AAGAATTGTTAGGAGGAGGAAGG + Intronic
1100958560 12:99936978-99937000 CAGAAACATAATGAGGATGAAGG - Intronic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101362105 12:104037414-104037436 AAGAATAATAAAGAAGAAAAGGG + Intronic
1102141894 12:110622148-110622170 AATAATAATAATGAGTTGAATGG + Intronic
1102230389 12:111257695-111257717 AAGATGGAGAATGAGGAGGAAGG - Intronic
1102241609 12:111328061-111328083 AACAATAATAATAATGATGAGGG + Intronic
1102688303 12:114741186-114741208 AATAATAATGAGGTGGAGGAAGG - Intergenic
1102751490 12:115298514-115298536 ATGAATAATAAGTTGGAGGATGG - Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102792348 12:115657936-115657958 GATGATAGTAATGAGGAGGAGGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1104351875 12:128051262-128051284 AAGAATAATAATGAAGAAGAGGG + Intergenic
1104352716 12:128058755-128058777 AATAATTATAAGGGGGAGGATGG - Intergenic
1105629444 13:22147548-22147570 AAAAATAAGAATGAGGAGATGGG - Intergenic
1105659132 13:22473588-22473610 TATGATAATGATGAGGAGGATGG + Intergenic
1105754788 13:23454244-23454266 TAGAATAATAAGGCTGAGGAAGG - Intergenic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1105993971 13:25652477-25652499 AAAAATAAGAATAAGGAAGAGGG - Intronic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1107540934 13:41388522-41388544 AAGAATAATAACAATGATGATGG - Intergenic
1107684262 13:42880916-42880938 AGGGATAATTATGAGAAGGAAGG + Intergenic
1107907165 13:45071899-45071921 AATAATAATAAAGAAGAGGCTGG - Intergenic
1108038786 13:46320400-46320422 AAAAAGAAAAAGGAGGAGGAAGG + Intergenic
1108068718 13:46605549-46605571 AAGAAAAATGAGGTGGAGGAAGG - Intronic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108132543 13:47318333-47318355 AAAAAAAATAATAAAGAGGATGG - Intergenic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1108464351 13:50699787-50699809 AAGAATAATAAGGAAAAGGCTGG - Intronic
1108598699 13:51972342-51972364 AAGAATTAGAGGGAGGAGGAGGG - Intronic
1108829503 13:54459865-54459887 AAGAATACCTATGAGGAGGCCGG - Intergenic
1108853318 13:54762562-54762584 AAGAAAAATGAGGAAGAGGAGGG + Intergenic
1108902586 13:55430946-55430968 AAAAATAACAGTGATGAGGAAGG - Intergenic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109106200 13:58253541-58253563 AAGAAGAAAAATGAGGAGGGAGG - Intergenic
1109756412 13:66766586-66766608 AATAAGAATAAGGAGGTGGAAGG + Intronic
1109914313 13:68960461-68960483 AAAAAAAATAATAGGGAGGAGGG + Intergenic
1109932854 13:69238782-69238804 ATGAATAATAATGTTGAGTAAGG + Intergenic
1110456066 13:75691779-75691801 CAGTATCCTAATGAGGAGGAGGG - Intronic
1110871614 13:80458920-80458942 AATAATAATAATGAAGAAGTTGG - Intergenic
1110943196 13:81378884-81378906 AACAATAATAATTTTGAGGAGGG + Intergenic
1111064035 13:83066624-83066646 AAGAATAAAAATTAAGTGGAAGG + Intergenic
1111319553 13:86609207-86609229 AAAAATCACAATGGGGAGGAAGG + Intergenic
1111508024 13:89220810-89220832 AAGAATATTAATGAAGAAAATGG + Intergenic
1111675743 13:91386452-91386474 AAAAAAAATAATGATGGGGAGGG - Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112066869 13:95802493-95802515 AAAAACAATAATGAGAACGAGGG + Intronic
1112571441 13:100597136-100597158 AAGAATAATCTAGAAGAGGAAGG + Intergenic
1112597526 13:100821919-100821941 AATGATATTAATTAGGAGGAAGG - Intergenic
1112876212 13:104042666-104042688 AACAACAATAATGAGAAAGATGG + Intergenic
1113148023 13:107230492-107230514 AATAATAATAATAATGAGGATGG - Intronic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114040652 14:18675420-18675442 AATAAAAATAATGAGGAGACTGG + Intergenic
1114045690 14:18873922-18873944 AATAAAAATAATGAGGAGACTGG + Intergenic
1114118521 14:19645546-19645568 AATAAAAATAATGAGGAGACTGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114504607 14:23199689-23199711 AGGAAAAATAGTGGGGAGGAAGG + Intronic
1114722146 14:24893946-24893968 AAGAATAAAAATCAGGACCAAGG + Intronic
1115574977 14:34702548-34702570 AATAATAATAATGAGATGGCCGG + Intergenic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115807432 14:37067115-37067137 AAGAAAAATAATGGGGAAGCAGG + Intronic
1115947058 14:38674124-38674146 AAGACTAATAAAGAGGAAAAGGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116389225 14:44372524-44372546 GAGAATAATCATGGGGAGTAAGG - Intergenic
1116669617 14:47823999-47824021 AATAATAAGAATGAAGAAGAGGG + Intergenic
1117034263 14:51711148-51711170 AAGAGTAATTATGAGATGGAAGG + Intronic
1117082337 14:52165299-52165321 CACACTAATGATGAGGAGGAAGG + Intergenic
1117287014 14:54295758-54295780 AAGAATTATAAAGGGGAAGAGGG - Intergenic
1117572332 14:57060219-57060241 AAGAATAATAATCAAGAGGAGGG - Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118298938 14:64597115-64597137 AACAATCATATTGAGGATGAAGG - Intergenic
1118451074 14:65902649-65902671 ATGAAAAATATTGAAGAGGATGG + Intergenic
1118602157 14:67478376-67478398 GAGAAGAGTAATGAAGAGGAGGG - Intronic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1118693940 14:68365235-68365257 AAGTAGAATAAAGAGGAGGCAGG + Intronic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1119489739 14:75020858-75020880 AATAATAATAATAATGAAGATGG - Intronic
1119688936 14:76655352-76655374 TAGAAGAATAACCAGGAGGAGGG - Intergenic
1119961580 14:78863834-78863856 TATAATGATGATGAGGAGGAAGG - Intronic
1120018769 14:79504233-79504255 ATGGATAATATTGAGGAGTAAGG - Intronic
1120332271 14:83108667-83108689 AAAGATGATGATGAGGAGGAAGG - Intergenic
1120403246 14:84060247-84060269 AAGAGTAATACTGAGCATGAGGG - Intergenic
1120511574 14:85421878-85421900 AAGAAGTAGAATGGGGAGGAGGG - Intergenic
1120613510 14:86673457-86673479 AAGAATAATAAAGCTGAGGATGG + Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121840996 14:97133612-97133634 AATAGTAATAATGATGATGATGG - Intergenic
1121889518 14:97575985-97576007 AACAATGATGATGATGAGGATGG + Intergenic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1122703633 14:103606788-103606810 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
1202936972 14_KI270725v1_random:97953-97975 AAGAAAAGTAAAGAGGAGGAGGG + Intergenic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1123482872 15:20650684-20650706 AAAAAAATTAATGAGGATGAAGG - Intergenic
1124454961 15:29833810-29833832 AAAAATATAAATGAGGAGGTTGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125120110 15:36146171-36146193 AAGAAAAGTAAAGAGGAGAAAGG - Intergenic
1125622878 15:41080135-41080157 AAAAATTATAATGATGAAGAAGG + Intronic
1125680050 15:41524867-41524889 AAGGATAAGAATGAGTGGGAGGG - Intronic
1126242858 15:46465680-46465702 AAGAATCACAATGATGATGAGGG + Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126776999 15:52109018-52109040 AAGTATAATAATGAGTGGGAAGG + Intergenic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1127216497 15:56828711-56828733 AAGAATAAGAATTAGAAAGAAGG + Intronic
1127453627 15:59139263-59139285 AGGAGTAATAATGAGGGGGTGGG - Intronic
1127453684 15:59139523-59139545 AGGAGTAATAATGAGGGGGTAGG - Intronic
1127453718 15:59139722-59139744 AGGAGTAATAATGAGGAGGTAGG - Intronic
1127453731 15:59139789-59139811 CAGAGTAATAATGAGCAGGTCGG - Intronic
1127821477 15:62660061-62660083 TAAAATAATAATGAGAAGGTTGG + Intronic
1128090107 15:64913391-64913413 AGGAATAATAGTGATGATGATGG + Intronic
1128601001 15:68995255-68995277 GAGAATAATAATAAAGAGAATGG - Intronic
1128609649 15:69063535-69063557 AAAAAAAAAAATGAGGAGGCGGG + Intergenic
1129291217 15:74569332-74569354 AATAATAATAATAATGAAGAGGG - Intronic
1130143980 15:81258171-81258193 GAGACTGATAATGAGGATGATGG - Intronic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1130557251 15:84931251-84931273 AATAAAAATAAAAAGGAGGAGGG - Intronic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131307269 15:91256217-91256239 AACAATATTAATTTGGAGGAAGG - Intronic
1131612878 15:93983510-93983532 AACAATAATAAGGAGAAGAAGGG + Intergenic
1131695385 15:94871654-94871676 AGGAATAACAATGAGAAGAAAGG - Intergenic
1131948488 15:97653510-97653532 CAGAATAATAGTGGGGAGGGGGG + Intergenic
1131965799 15:97840933-97840955 AAGAAGAGTAAGGGGGAGGATGG - Intergenic
1132458911 16:39823-39845 AATAATAATAATAATGATGATGG - Intergenic
1133392635 16:5422375-5422397 GAGAAGAGAAATGAGGAGGAGGG + Intergenic
1133482305 16:6183178-6183200 AAGAATAATAAAGGTAAGGAGGG + Intronic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1133958137 16:10465128-10465150 AATTTTAATAATGAGTAGGATGG - Intronic
1134377031 16:13686485-13686507 AATAATAATAAAGAGAAGAAAGG - Intergenic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134872865 16:17667482-17667504 ATGACTACTATTGAGGAGGAAGG + Intergenic
1134886096 16:17792995-17793017 AAAAAAAAAAATGGGGAGGAAGG + Intergenic
1135432967 16:22402250-22402272 AAGAATAAAAATGAGGGGGATGG - Intronic
1135508315 16:23058760-23058782 AACAATAGTGATGAGGAGGAGGG - Intergenic
1136138833 16:28275945-28275967 AAAAGAAAGAATGAGGAGGACGG + Intergenic
1136156192 16:28383850-28383872 AAGAAAAATAAAGCAGAGGACGG + Intronic
1136206894 16:28731438-28731460 AAGAAAAATAAAGCAGAGGACGG - Intronic
1136318714 16:29468724-29468746 AAGACAAAGAATGAGGAGGGTGG + Intergenic
1136433286 16:30208068-30208090 AAGACAAAGAATGAGGAGGGTGG + Intronic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136599359 16:31274313-31274335 AAGAAAAAGAAAGAGGAGAAAGG + Intronic
1136638375 16:31540416-31540438 AACACTCATGATGAGGAGGAAGG + Intergenic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137623247 16:49890812-49890834 AGTAATAATAATGATGAAGATGG + Intergenic
1137798462 16:51241257-51241279 AAGAGAAATAGGGAGGAGGAGGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138536502 16:57663211-57663233 GAGAATAGTAATGAATAGGATGG + Intronic
1138844747 16:60552318-60552340 AAGAATGTTAATGAGGAACAAGG - Intergenic
1139094371 16:63686402-63686424 AATAATAATAATAATGATGATGG + Intergenic
1139707955 16:68754867-68754889 AAGAATAAAACTCAGCAGGAAGG + Intronic
1140339587 16:74144191-74144213 AAGAATCATAAAGTGGAAGATGG + Intergenic
1140781931 16:78304938-78304960 AAGAAAAAAAAAGAGGAAGAAGG - Intronic
1141520442 16:84575337-84575359 AAAAATAAAAATGAAAAGGATGG - Intronic
1141530453 16:84643034-84643056 AAAAATACTGGTGAGGAGGAGGG + Intergenic
1141544147 16:84752462-84752484 AAGAATAAAAATGAGGAAGGCGG - Intronic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1143725629 17:8843322-8843344 CAGAATAAGAAAGAGGAAGAAGG - Intronic
1144204113 17:12967090-12967112 AAAAAAAAAAATGAGGAAGAAGG - Intronic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1144289135 17:13808734-13808756 AAAAAAAATCATAAGGAGGAGGG - Intergenic
1144390384 17:14788180-14788202 AAGAACAGCAATGAAGAGGATGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1145735007 17:27222755-27222777 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1146101887 17:29991039-29991061 CACACTGATAATGAGGAGGAAGG - Intronic
1147114993 17:38292468-38292490 AAGAAATATAATGAGGCAGAAGG - Intergenic
1147272247 17:39282515-39282537 AAAAATAAACTTGAGGAGGAGGG - Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147563872 17:41524838-41524860 AAGAAGAACCATGAGGAGGTGGG - Exonic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148414623 17:47496742-47496764 AAGAAATATAATGAGGCAGAAGG + Intergenic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1148524789 17:48321337-48321359 AATAATAATAATGAGACAGAAGG - Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149126808 17:53244521-53244543 AATAATACTAACCAGGAGGAGGG + Intergenic
1149211247 17:54304044-54304066 AAGTTTAATAATGTGGAAGAGGG - Intergenic
1150290167 17:63976564-63976586 TAGAATAATAATAAGAAGCAAGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150678558 17:67265658-67265680 AAAAATAATAGTGCGGAGGCTGG - Intergenic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150797682 17:68252052-68252074 AAGAACAATAATTAAGGGGAGGG - Intronic
1151018256 17:70582654-70582676 AAGAAAAAATAGGAGGAGGAAGG - Intergenic
1151107665 17:71636570-71636592 AAGAAAGAAAAAGAGGAGGAAGG - Intergenic
1151256083 17:72877782-72877804 AAAAATAAAAATGAAGATGAAGG - Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152163565 17:78685335-78685357 AATAATAAAAATCAGGAGGTGGG - Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153658420 18:7305589-7305611 AAGAGGAATAATGAAGTGGATGG + Intergenic
1154182857 18:12152192-12152214 AAAAAAAAAACTGAGGAGGAGGG + Intergenic
1154389849 18:13927138-13927160 AAGGTTAAAAATGAGAAGGATGG + Intergenic
1154473101 18:14723778-14723800 AATAATAATAATAAGGAGCTGGG - Intergenic
1155106688 18:22673948-22673970 AAGATGAAAAATGAGGAAGATGG + Intergenic
1155614244 18:27702756-27702778 AAGAATGATAGTGAGAAGGTAGG - Intergenic
1156003023 18:32406841-32406863 AAGTATAAGACTGAAGAGGAAGG + Intronic
1156040129 18:32811065-32811087 AAGAATAAGAATTAAGGGGATGG + Intergenic
1156174878 18:34532284-34532306 AAAAATAATAATGGGGAAGAAGG + Intronic
1156686842 18:39660186-39660208 TAAAATAATAATGATGAGAATGG + Intergenic
1156723921 18:40104564-40104586 AAGCAAAATAAGGAGGAGAAGGG + Intergenic
1156735273 18:40250030-40250052 AAAAAAAAGAATGATGAGGATGG + Intergenic
1156742205 18:40345026-40345048 AAGAATATTCATGAGGTGAAAGG + Intergenic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1157933502 18:51849006-51849028 AAGAATTATAAACATGAGGAGGG - Intergenic
1158208308 18:55019295-55019317 AAGAATAATATTCAATAGGAGGG - Intergenic
1158238542 18:55349546-55349568 AAGAATGAAAAAAAGGAGGAAGG + Intronic
1158337070 18:56423988-56424010 AACAAAAAAAATGAGGAAGAAGG + Intergenic
1158369865 18:56788335-56788357 GACAATAAAAAAGAGGAGGAAGG - Intronic
1158494656 18:57943480-57943502 AAGAAAAATGAGGAGAAGGAGGG - Intergenic
1158826061 18:61221033-61221055 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1159234472 18:65653256-65653278 AAGAATATTAAGGAGTAGGCCGG + Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159672215 18:71235752-71235774 AAGAAAAATGAAGAGGAAGAGGG + Intergenic
1159685238 18:71410727-71410749 AACAATATTATTGTGGAGGATGG + Intergenic
1159847827 18:73486994-73487016 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161377168 19:3945828-3945850 AAAAATAATAATGATTAAGATGG + Intergenic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161863043 19:6812854-6812876 AAGAATGGTGATGAGGAGAATGG + Intronic
1162011026 19:7815253-7815275 AAGAAGAATAAGGAACAGGATGG - Intergenic
1162050692 19:8030784-8030806 AAAAAAAAAAATGAGGAGGCAGG + Intronic
1162184399 19:8893747-8893769 AATAATAATGATGATGATGACGG - Intronic
1163057558 19:14732023-14732045 AAGATGGAAAATGAGGAGGAAGG - Intronic
1163120595 19:15215103-15215125 AAAAATAATAATAAAGAGGCTGG + Intergenic
1163307857 19:16493130-16493152 AACAAGAACAATGAGGAAGAAGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1163613945 19:18315531-18315553 AAGAAAATTAATGAGGTGGAAGG - Intronic
1163866760 19:19779633-19779655 AAGAAAAACTATGTGGAGGATGG - Intergenic
1163886998 19:19974551-19974573 AATATTGATAATCAGGAGGAAGG + Intergenic
1164032258 19:21418314-21418336 CACACTGATAATGAGGAGGAAGG - Intronic
1164110392 19:22151623-22151645 AAGACTAATAAAGAAGAAGAGGG + Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164841453 19:31395937-31395959 AAGAAGAAAAAGGAGGAGAATGG + Intergenic
1165799332 19:38537951-38537973 CACAATAATGGTGAGGAGGAGGG + Exonic
1166024835 19:40072666-40072688 AAAAAGAAGAATGAGGAGAAAGG + Intronic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167921118 19:52784086-52784108 AATAATAATAATTAGTAGGTAGG + Intronic
1168082111 19:54017721-54017743 AAGAAGTAAAAGGAGGAGGAGGG - Intergenic
1168319842 19:55502345-55502367 AAGAAAAAAAATGAGAAAGATGG - Intronic
1168419082 19:56189228-56189250 AAGAATAAAAATTAGAAGTAAGG - Intergenic
1168510173 19:56967417-56967439 GAGAAGGAAAATGAGGAGGAGGG - Intergenic
1168545648 19:57247655-57247677 AATAATCATGATGAGGACGACGG - Intronic
1168673669 19:58260580-58260602 AAGAATAAGAATAAGCAGGGAGG - Intronic
1202655042 1_KI270708v1_random:12745-12767 CACACTGATAATGAGGAGGAAGG + Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925019990 2:560924-560946 AAAAATAATAAACAGCAGGATGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925943260 2:8839341-8839363 AAGAATAGAGATGAGAAGGAGGG + Intergenic
926129958 2:10296804-10296826 AAGTTTGCTAATGAGGAGGAGGG + Intergenic
926190650 2:10724943-10724965 AAGAAAAATAATTAGGAGGCTGG - Intronic
926266838 2:11330873-11330895 AGGAAGAGGAATGAGGAGGAGGG + Intronic
926316882 2:11716333-11716355 AAAACCAAAAATGAGGAGGAAGG + Intronic
926452158 2:13018445-13018467 AAGAAAACCATTGAGGAGGAAGG + Intergenic
926489071 2:13501423-13501445 AAGAATATTCATGAGGCAGAAGG - Intergenic
927374233 2:22394752-22394774 AAGGATTATAATGATGAGAAAGG + Intergenic
927754369 2:25697088-25697110 AAGTACAGTAATGAGAAGGAGGG + Intergenic
927837073 2:26407659-26407681 AACCATAAACATGAGGAGGAGGG - Intronic
928256357 2:29726314-29726336 TAGAATAATAATCAAAAGGAAGG + Intronic
928703077 2:33918795-33918817 CACACTGATAATGAGGAGGAAGG - Intergenic
928932637 2:36639913-36639935 AATAATAATAATAACTAGGAGGG + Intronic
928955647 2:36864689-36864711 AATAAAAATAAAGAGGAAGAGGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929022570 2:37568050-37568072 AAGAATAAAAATGAGGAAATAGG + Intergenic
929235230 2:39598109-39598131 AAGATTTGTGATGAGGAGGAGGG - Intergenic
929355749 2:41022249-41022271 AAGAAAATTATTGAGGTGGAAGG + Intergenic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929532010 2:42758693-42758715 AAGAAAAATACTGGGGAGGAGGG - Intergenic
929792063 2:45030714-45030736 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930391173 2:50763495-50763517 AATAATAATAATTTGAAGGAGGG - Intronic
930426371 2:51217879-51217901 AAGAAGAAAAATGAAGTGGATGG + Intergenic
930542271 2:52721495-52721517 AAGAAGAATAAGGAAGAGCAAGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930885896 2:56326007-56326029 AAGTATAATGATAAGGAAGAGGG + Intronic
931099169 2:58976098-58976120 AGAAAGAACAATGAGGAGGAGGG + Intergenic
931129519 2:59318465-59318487 AACAAGAAGAATAAGGAGGAGGG + Intergenic
931165663 2:59744896-59744918 AACTATAACATTGAGGAGGAAGG + Intergenic
931300756 2:60975737-60975759 AAGAAAAAGAATGAGGCTGAAGG - Intronic
931476569 2:62593887-62593909 TAGAACAAAAATGTGGAGGAAGG + Intergenic
931527455 2:63172519-63172541 AAAAATAATAATAAAGAGGTAGG + Intronic
931549620 2:63428191-63428213 AAAAAAAAAATTGAGGAGGAGGG + Intronic
931729026 2:65136804-65136826 AAGAAGAGTAATGAGAAGGAAGG + Intergenic
931942036 2:67262741-67262763 AACAATAATAATAAAGAGGGTGG - Intergenic
932378292 2:71258112-71258134 TAGAATAATGATGATGATGATGG - Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933358037 2:81239584-81239606 AAGAAGAATAATGCAGAGAAAGG - Intergenic
933427973 2:82137412-82137434 TAGAATAATAATGAGAGGGGAGG + Intergenic
933769099 2:85731941-85731963 AAGAAGCCTAATGAGGAAGAGGG - Intergenic
933803170 2:85979078-85979100 AAGAATGAGAAAGAGAAGGAAGG - Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934753770 2:96811028-96811050 ATAAATAATAATCAGGCGGAAGG - Exonic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
935150817 2:100433560-100433582 AAGAACAAAAATGTGGAGGAAGG + Intergenic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935667260 2:105523530-105523552 AGGAATAATAATCAGCTGGAGGG + Intergenic
936484124 2:112912028-112912050 AAAAATAAAAATGACAAGGAAGG - Intergenic
936704017 2:115049217-115049239 AATAATAATAATGATGAAGTTGG + Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937828432 2:126393091-126393113 AAGAATAAAAAGGTGTAGGAAGG + Intergenic
938004086 2:127773411-127773433 AATAACAACAAGGAGGAGGAGGG + Intronic
938142093 2:128803064-128803086 AAGAATTATTATCAGTAGGAAGG + Intergenic
938157750 2:128956089-128956111 AAGTATAAGAATGAGGTGGTAGG - Intergenic
938214122 2:129493796-129493818 AAGAAAAAGAATGAAGAAGAAGG + Intergenic
938269533 2:129957126-129957148 AATAAAAATAATGAGGAGACTGG - Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938744818 2:134267484-134267506 GGGATTCATAATGAGGAGGAGGG - Intronic
938758359 2:134401060-134401082 AAGAAGAATAAGGAGAAGGAAGG - Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939587334 2:144020984-144021006 AAAAACAAAAATAAGGAGGATGG + Intronic
939726901 2:145732019-145732041 AATAATAATAATAAGAAGGCAGG + Intergenic
939946754 2:148420520-148420542 AAGAATAATAAAGAGAATGTGGG - Intronic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940767406 2:157805160-157805182 AACTATAATATTGAGGATGAGGG + Intronic
940967834 2:159859909-159859931 AAGAATAATAAGGATGGTGATGG - Intronic
941073184 2:160977727-160977749 AAAAAAATTAATGTGGAGGAAGG + Intergenic
941117996 2:161493751-161493773 AAGAATAATAAATTGGAGAAGGG + Intronic
941244006 2:163074042-163074064 AAGTATAATGATGAGGAGTGTGG + Intergenic
941836796 2:170031094-170031116 AATAATAAAAATAAAGAGGAAGG - Intronic
942012355 2:171775709-171775731 AATAATAATAATGAGGGGCTGGG + Intergenic
942025206 2:171904030-171904052 CAGAATGGTAATGAGGAGCATGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942527134 2:176865904-176865926 AAGAATAATAATGTGTAGTGGGG + Intergenic
942917408 2:181328006-181328028 AAGAATAAAAGTGCTGAGGAAGG - Intergenic
943046014 2:182863367-182863389 ATGAATAATAATGGTCAGGATGG + Intronic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
943795692 2:191990022-191990044 AGGAATAGTAATGAGGATTAAGG - Intronic
943887238 2:193234910-193234932 AATAATAATAATGAAGGAGATGG + Intergenic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
944154544 2:196595601-196595623 AAGAAAAGAAAAGAGGAGGAAGG + Intergenic
944183280 2:196919751-196919773 AAGAATAAGATAGAGTAGGATGG - Intronic
944343911 2:198637322-198637344 AAGAAAAATAAAGTGGAGGTAGG - Intergenic
944541856 2:200761611-200761633 AAGAATAAGGATGAAGAGGGTGG + Intergenic
944584149 2:201158845-201158867 AATAATAATAATAATGATGAGGG - Intronic
944604478 2:201339085-201339107 AAGACCAATAATGAGTAGCAAGG - Intronic
944674515 2:202023913-202023935 TAGAATAATAAGGGGGAGGCAGG + Intergenic
944704008 2:202270791-202270813 AAAAATGAAAATGAGGAGGCTGG + Intronic
944732648 2:202533219-202533241 AAGAAGAGAAAAGAGGAGGAAGG - Intronic
945195253 2:207231510-207231532 AAGAAAAAAAAGGAGGGGGAGGG + Intergenic
945460981 2:210108061-210108083 AAGAAAAAAATTGAGAAGGATGG - Intronic
945500622 2:210568913-210568935 AAAAGAAATAATCAGGAGGATGG + Intronic
945735319 2:213591747-213591769 AAGAAGAAACATGAGGAGTAAGG + Intronic
946725764 2:222659835-222659857 GAGAATAAAAAGGGGGAGGAAGG - Intergenic
946900088 2:224364044-224364066 TAGAATAATAATGATCATGATGG - Intergenic
947248064 2:228072066-228072088 TAGAATAAAAAAGTGGAGGAAGG + Intronic
947281190 2:228457088-228457110 AAAAAAAAAAATGAGGAGGAGGG - Intergenic
947283972 2:228489582-228489604 AAGCATAACAATGATGAGAATGG - Intergenic
948286238 2:236787602-236787624 AAGAGAAAAAATGAGGAAGATGG - Intergenic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169622806 20:7526927-7526949 AAAAATAATAATGTGCAGGCCGG - Intergenic
1169725635 20:8726501-8726523 AACAACAATCATGAGGCGGAAGG + Intronic
1171053922 20:21887616-21887638 AATAATAATAAGGAGGAAGCAGG - Intergenic
1171128430 20:22625497-22625519 AATAATAATAAGGAAGAGGAGGG - Intergenic
1172138218 20:32702420-32702442 AAAAAAAATTCTGAGGAGGAGGG + Intergenic
1172816695 20:37692859-37692881 AAAAAGAATAATGAGGAGAGAGG + Intergenic
1172856588 20:38008967-38008989 AAAAAAAAAAATGAGGTGGAGGG - Intronic
1173398521 20:42703184-42703206 GAGAATAAGAATGTGGAGAAAGG + Intronic
1173483115 20:43418902-43418924 AAGAAAAATAAAGAGGGAGAGGG + Intergenic
1173581536 20:44150197-44150219 CATAAAAAAAATGAGGAGGATGG + Intronic
1174757359 20:53173310-53173332 AATAATAATAAAGCGGAGGCTGG + Intronic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175539320 20:59738318-59738340 AAGGATGATAATAAGGGGGAGGG + Intronic
1175671411 20:60906188-60906210 AATAATGGTAATGAGGATGATGG + Intergenic
1175671476 20:60906827-60906849 GAGGCTAATAATGATGAGGATGG + Intergenic
1176586343 21:8591024-8591046 AAGAAAAGTAAAGAGGAGGAGGG - Intergenic
1176640728 21:9301200-9301222 CACACTGATAATGAGGAGGAAGG + Intergenic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1176801380 21:13434071-13434093 AATAATAATAATAAGGAGCTGGG + Intergenic
1176961605 21:15165061-15165083 AAGGTTAATAATGAGCATGATGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177684020 21:24413651-24413673 AAGAATAAAAATGAGTAGTCTGG + Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178236559 21:30849361-30849383 AATACTATTAAAGAGGAGGATGG + Intergenic
1178389421 21:32185970-32185992 AAGCATGATAATGAGGCTGAAGG - Intergenic
1178733427 21:35127013-35127035 AAGCATAAGAATGAGCAGAATGG + Intronic
1179080182 21:38163478-38163500 AAGAGTAACAATGAGGAGATGGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179303669 21:40135626-40135648 AAGAAAAACAATGAGCAGGAAGG - Intronic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1179838663 21:44055583-44055605 AAAAAAAAAAAGGAGGAGGAAGG + Intronic
1180269149 22:10567927-10567949 AAGAAAAGTAAAGAGGAGGAGGG - Intergenic
1180349752 22:11790583-11790605 CACACTGATAATGAGGAGGAAGG + Intergenic
1180388452 22:12201656-12201678 CACACTGATAATGAGGAGGAAGG - Intergenic
1180464221 22:15596539-15596561 AATAAAAATAATGAGGAGACTGG + Intergenic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1180763463 22:18226685-18226707 AATAATAATAAAGAGGCAGAAGG + Intergenic
1180772181 22:18397858-18397880 AATAATAATAAAGAGGCAGAAGG - Intergenic
1180793707 22:18591724-18591746 AATAATAATAATAAAGAGGGTGG + Intergenic
1180803560 22:18647475-18647497 AATAATAATAAAGAGGCAGAAGG - Intergenic
1180807205 22:18721972-18721994 AATAATAATAAAGAGGCAGAAGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1180894463 22:19319390-19319412 AAGTATAAAAATTAGGAAGAAGG - Intergenic
1181218158 22:21347789-21347811 AATAATAATAAAGAGGCAGAAGG + Intergenic
1181364835 22:22367944-22367966 AAGAAGAATGATGATGAGCAGGG - Intergenic
1181367982 22:22394261-22394283 AAGAAGAATGATGATGAGCAGGG - Intergenic
1181374794 22:22448508-22448530 AAGAAGAATGATGATGAGCAGGG - Intergenic
1181789708 22:25255488-25255510 CAGCATAGTAATGAGGAAGATGG + Intergenic
1182495618 22:30705264-30705286 AACAAAAATACTGGGGAGGAAGG - Intronic
1182509977 22:30812148-30812170 AAAAATAAAAATGAGAAGGCTGG - Intronic
1182679871 22:32070285-32070307 AAGAAGAAGAATGAAGAAGAAGG - Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183367689 22:37415967-37415989 AAAAATAATAATAATGATGATGG + Intronic
1183367690 22:37415970-37415992 AATAATAATAATGATGATGGTGG + Intronic
1183944119 22:41314586-41314608 AAAAATAATAATGATGATTATGG - Intronic
1184412308 22:44332256-44332278 AGGAAGGAAAATGAGGAGGAAGG - Intergenic
1184548167 22:45187767-45187789 AACAATCATACTGAGGACGAAGG + Exonic
1184720779 22:46311819-46311841 AAGAATGATAATGAGAAAGCTGG - Intronic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1203234020 22_KI270731v1_random:138848-138870 AATAATAATAAAGAGGCAGAAGG - Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949266958 3:2169149-2169171 AAGAGTAATAATAAGGAAGCTGG - Intronic
949620123 3:5801434-5801456 AATATTAATAATGAGAAGAATGG - Intergenic
949751706 3:7359323-7359345 AAAAAAAAAAAAGAGGAGGAGGG - Intronic
949929445 3:9067150-9067172 AGGGATAATAATGATGATGATGG - Intronic
949981793 3:9506557-9506579 AATAATAATAATAATGAGGATGG - Intronic
950718641 3:14867022-14867044 AAGAAGAATGAGGGGGAGGAGGG - Intronic
951333843 3:21397866-21397888 AACAATGATAATGATGATGATGG - Intergenic
951654529 3:24990716-24990738 AAGAGTAATAATGAGGAGGCAGG - Intergenic
952042703 3:29279713-29279735 AAGAATAACAATCAGAAGGAAGG - Intergenic
952148436 3:30559409-30559431 AGTGATAATAATGAGGAGAAAGG + Intergenic
952163040 3:30714826-30714848 AAAAATAAAAATGAAGGGGAGGG - Intergenic
952308066 3:32162709-32162731 AAGCATATTAATTGGGAGGAGGG + Intronic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953895734 3:46798692-46798714 CAGAACAAAAATGTGGAGGAAGG + Intronic
953950307 3:47184489-47184511 AAAAATAATAATAAGAAGAAAGG - Intergenic
954231307 3:49219844-49219866 CATACTAATGATGAGGAGGAAGG + Intronic
954503969 3:51050700-51050722 AAGAATAAAAAGGCAGAGGAAGG - Intronic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955348761 3:58179294-58179316 AAGCCTACTAATGGGGAGGATGG + Intergenic
956002049 3:64739948-64739970 AAGATTAATTAAGAGCAGGATGG - Intergenic
956186858 3:66570765-66570787 AATAATAATAATGGGGAACATGG + Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956592826 3:70933307-70933329 AAGCCTGATAATGAGCAGGAAGG - Intergenic
956885570 3:73555870-73555892 AAGAACAATAAGGATGTGGAAGG - Intronic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957962344 3:87272837-87272859 AAGAAATATAATGATGAGGGGGG + Intronic
958006842 3:87823279-87823301 AAAAATAATACTAAGGAGAATGG - Intergenic
958049195 3:88322632-88322654 ATGTATAATATTTAGGAGGAAGG - Intergenic
958159360 3:89797122-89797144 AATAATTATAAAGAGGAGTAAGG - Intergenic
958262559 3:91398644-91398666 AGGAAAGATAATGAGGGGGAAGG + Intergenic
958931780 3:100215225-100215247 AAAAAAAAAAATGTGGAGGAAGG - Intergenic
959195723 3:103179128-103179150 AAAAATAAAAAAGAGGATGAGGG + Intergenic
959197904 3:103209642-103209664 CACACTAATGATGAGGAGGAAGG + Intergenic
959260632 3:104075254-104075276 GAGAATAACAGTGAGTAGGAAGG + Intergenic
959468083 3:106714767-106714789 AAGAATAACATGGAGAAGGAAGG - Intergenic
959769835 3:110080445-110080467 AAGAATAAAAAGGCAGAGGAAGG + Intergenic
959936584 3:112035776-112035798 AAGAAAATAAAAGAGGAGGAAGG + Intronic
959965206 3:112346282-112346304 AAAAAGAAAAATTAGGAGGAAGG - Intronic
960173966 3:114495725-114495747 AGGAAAAGAAATGAGGAGGAAGG + Intronic
960799765 3:121526563-121526585 AAGAAAATTATTGAGGAGAAAGG - Intronic
960812149 3:121635675-121635697 AAGAAAAAGAATGAGGGAGAAGG + Intronic
960849113 3:122033918-122033940 AAGAAGAAAAATGAGGTGGAAGG - Intergenic
961117966 3:124348135-124348157 AAACAAAATAATGAGGAGTAAGG + Intronic
961573026 3:127813944-127813966 GGGAAAAATAAGGAGGAGGAAGG - Intronic
962673932 3:137738183-137738205 AAGAATAATAATGAGGGAAATGG - Intergenic
962815698 3:138996147-138996169 AAGAATAAAGCTGAAGAGGAAGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962959847 3:140300616-140300638 AAGAATAATAAGTAGGAGCTAGG + Intronic
963357411 3:144226866-144226888 AATAATAATAATGAGTAAAAGGG - Intergenic
963520096 3:146353417-146353439 AAGAATAGTACCAAGGAGGAGGG + Intergenic
963665892 3:148185458-148185480 TAGAATAATAATGAGAAGTTGGG - Intergenic
963751639 3:149185771-149185793 AAGAAAAATAAGGCAGAGGAAGG - Intronic
963896707 3:150694107-150694129 AAGAAAAAATAGGAGGAGGAAGG - Intronic
964112822 3:153105019-153105041 AAGAATAAGAATGAGAATTAAGG + Intergenic
964269751 3:154942334-154942356 AAAAATAATAATAAGAAGAAAGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964551411 3:157888963-157888985 AAGATTATTAAAAAGGAGGAAGG - Intergenic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
965836115 3:172854658-172854680 AAGAATATTAATAAGGTTGAGGG + Intergenic
966384945 3:179386805-179386827 AAGAAGAATAGTGATTAGGAGGG - Intronic
966571037 3:181443358-181443380 AATAATAAAAATGAAGAGAAAGG - Intergenic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
966992160 3:185243396-185243418 AAAAATAATAATGAGGATTAAGG - Intronic
967154294 3:186678410-186678432 AATAATAATAAATAGGGGGAGGG - Intergenic
967368564 3:188716420-188716442 AAAAAAAACAATGAGGAGGATGG + Intronic
967374618 3:188786797-188786819 AAGAATTATACTGAGTGGGAAGG + Intronic
967560843 3:190917892-190917914 AAAAAAAAAAATGGGGAGGAAGG - Intergenic
967796000 3:193599380-193599402 AAGAATAAAAAAGAGAAAGAAGG - Intronic
967844634 3:194034031-194034053 AAAAATAATACTGTGGAGGCTGG + Intergenic
967979313 3:195056050-195056072 AAGCTTAAAAGTGAGGAGGAGGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968169329 3:196496846-196496868 AAGAATAAATATACGGAGGACGG + Intronic
968239640 3:197065567-197065589 AAGGACAATAATATGGAGGATGG + Intronic
1202746165 3_GL000221v1_random:103824-103846 CACACTGATAATGAGGAGGAAGG - Intergenic
969270280 4:6095000-6095022 AAGAAAAATAAAAAGGAAGAGGG + Intronic
969806390 4:9612217-9612239 AATAATAATAATAATGATGATGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970569350 4:17364590-17364612 AAGATCAATAAGTAGGAGGAGGG + Intergenic
970937752 4:21594564-21594586 AGAAATTATAATGGGGAGGAGGG + Intronic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971479097 4:27098688-27098710 AAGAATGACAAGGATGAGGATGG - Intergenic
971799123 4:31265921-31265943 AAGAATAATAAAGAGATGAAAGG + Intergenic
971826802 4:31633876-31633898 AAGAAAACTAATGAGGTGGTTGG - Intergenic
971964387 4:33533603-33533625 AAGATAAGTAATGAGGAGAAAGG - Intergenic
971991498 4:33902455-33902477 AAAAATAATCATTAGAAGGAAGG + Intergenic
972080204 4:35140449-35140471 CACACTGATAATGAGGAGGAAGG + Intergenic
972417987 4:38861502-38861524 CAGAAGAATAATGAAGAGGATGG - Intergenic
972767937 4:42168983-42169005 TAGAATAAAAATGGGGAGTAAGG - Intergenic
972786509 4:42331491-42331513 AAGATTAATGAAGATGAGGATGG + Intergenic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974816107 4:67005420-67005442 AAGATTAATATTGTGGAGAAAGG - Intergenic
974928852 4:68337299-68337321 AACACTGAGAATGAGGAGGAAGG - Exonic
974988576 4:69058982-69059004 GAGAATAATAATAAGGAGAAGGG + Intronic
975431000 4:74290749-74290771 CAGAAAAGTAATGAGGAGGATGG - Intronic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
976087728 4:81423247-81423269 TAGAAAATTAAAGAGGAGGAAGG - Intergenic
976201469 4:82583554-82583576 AACAATATTAATGAGGAAGGAGG - Intergenic
976331629 4:83838292-83838314 GAGAATAATAAAGATGAGAATGG - Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
977051516 4:92133860-92133882 GAAAAAAAAAATGAGGAGGAGGG + Intergenic
977143645 4:93407870-93407892 AAAAATAAAAATGAAGAAGAAGG - Intronic
977189747 4:93984875-93984897 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
977367736 4:96093093-96093115 AAGGATAATGATGATGAGGCTGG - Intergenic
977443722 4:97101908-97101930 CACACTAATGATGAGGAGGAAGG - Intergenic
977547950 4:98407838-98407860 AATAATAATAAGCAGAAGGAAGG + Intronic
978333266 4:107638651-107638673 TAGAATAATAATCAGTGGGAGGG - Intronic
978543167 4:109840927-109840949 AATAATAATAATGATGATGGTGG - Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978609293 4:110519639-110519661 TTGAATAATAATGATGATGATGG - Intronic
979647166 4:123083674-123083696 AAAAATAATTATGAGGTGGGAGG - Intronic
979982766 4:127276759-127276781 CACACTAATGATGAGGAGGAAGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980276874 4:130664413-130664435 AAGAATAGTAATAAGATGGATGG - Intergenic
980951728 4:139385762-139385784 AAGCAGAATAATGTGGAGGTTGG - Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981138806 4:141243029-141243051 AAGAATATTATTGAGGATCAGGG - Intergenic
981260285 4:142710524-142710546 AAAGATAATAAAGAGGAGAATGG + Intronic
981435771 4:144720308-144720330 AAGACTCATAATGAGGTGTACGG + Intronic
981797026 4:148606972-148606994 ATGAATATTAATGCAGAGGAAGG + Intergenic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982066595 4:151659871-151659893 AAGAATAATAATGTGGAACTGGG - Intronic
982169574 4:152648030-152648052 AAGAAGAAAAAAGAGAAGGAAGG + Intronic
982204424 4:152986837-152986859 AAGAAAAATAGAGAGAAGGAAGG - Intergenic
982217695 4:153096282-153096304 AATAAAAATAAAAAGGAGGAGGG + Intergenic
982344248 4:154339243-154339265 AAGAACAAAAAGGTGGAGGAAGG - Intronic
983272853 4:165583477-165583499 AAGAATAACAAAGAAGAGCAAGG + Intergenic
983305667 4:165982584-165982606 AAGAATAATAATAACCAGAAAGG + Intronic
983325242 4:166246041-166246063 AAGAAAAATAAAGAGGTTGATGG + Intergenic
983647666 4:170008221-170008243 GGGAATAAAAATGAGGAAGAGGG - Intronic
984002415 4:174266255-174266277 AATAATAATAATGGGGAGGTTGG + Intronic
984227519 4:177052877-177052899 AAGAATAATAAAAAAGAGGGAGG + Intergenic
984374589 4:178911419-178911441 AAGAAGAGGAATGAGGAGAACGG + Intergenic
984892726 4:184508043-184508065 AAAAATAAAAATGAGTAGGCCGG + Intergenic
985916559 5:2923918-2923940 AAGATGACTAATGAGGATGAGGG + Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986600841 5:9470985-9471007 AATAATAATTATGATAAGGAGGG + Intronic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987574046 5:19703388-19703410 CACAATGATGATGAGGAGGAAGG + Intronic
987601722 5:20080705-20080727 AAGAAAAATGATTAGGAAGAAGG + Intronic
987617954 5:20301422-20301444 AACAATCATACTGAGGATGAAGG - Intronic
987700635 5:21393556-21393578 AATAATAATAATGATAATGAAGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988348919 5:30075257-30075279 ACAAAAAAAAATGAGGAGGAGGG + Intergenic
988682678 5:33499126-33499148 TAAATTAATAATGAGTAGGAGGG - Intergenic
988980568 5:36564060-36564082 AAGAGTAATGAAGAGGTGGATGG + Intergenic
989758700 5:44986938-44986960 CACACTAATGATGAGGAGGAAGG + Intergenic
989760053 5:45004075-45004097 AAGAAAAATAATGAGGAGTTTGG - Intergenic
989978355 5:50612121-50612143 AAGAAAAACATTGAGGAGAAAGG + Intergenic
990174766 5:53095228-53095250 AAAAATCATAATAAGCAGGAAGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990462335 5:56041008-56041030 AAAAATAATAATAAGGAATAGGG - Intergenic
990555565 5:56931762-56931784 AGGAATAATAATGGTAAGGAAGG + Intronic
991055861 5:62319360-62319382 AAGAATAAGACTGAAGAGGCAGG - Intronic
991476786 5:67029727-67029749 AAGAATGAAAGTGAGGTGGATGG + Intronic
992005888 5:72476857-72476879 AAGCTTAACAATGAGGAAGAGGG + Intronic
992090528 5:73312274-73312296 AGGCATAAAAATGAGGAGCAAGG - Intergenic
992351182 5:75930836-75930858 AAGAGTAATAATGAGCAGGCTGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
993162289 5:84307840-84307862 AAGAATATGAATTAGAAGGAGGG + Intronic
993407952 5:87535508-87535530 AAGAAAGAGAAAGAGGAGGAAGG - Intergenic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
993590374 5:89788095-89788117 TAGAACAAAAATGTGGAGGAAGG + Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995383298 5:111560986-111561008 GAGAAAAATAAAGAGGGGGAAGG + Intergenic
995385794 5:111587257-111587279 AACAACAATAATGAGGAGAGTGG + Intergenic
995432078 5:112090743-112090765 AAGAATATTAATGAGCAACAAGG + Intergenic
995576698 5:113543958-113543980 AAGAATAATAAAGGAGAGTAAGG - Intronic
996003909 5:118398252-118398274 AAGTATAATAAAGAGGATGGGGG - Intergenic
996174103 5:120333288-120333310 AACAATAAAAAGGAGGAAGAAGG - Intergenic
996259924 5:121454432-121454454 GAGAATAATAATGAGAAAGTTGG - Intergenic
996276706 5:121675460-121675482 AAAAACAGTAATGAGTAGGAGGG - Intergenic
996418308 5:123233927-123233949 AAGAAAAATAAAGAGAAAGAAGG - Intergenic
996424641 5:123300827-123300849 AAGAATACTAATGTGCAGCAAGG + Intergenic
996468204 5:123827607-123827629 AAGAATAAAAAAGAGAAAGAAGG + Intergenic
996855505 5:128001649-128001671 AAAAATAAAAAGGAGGAGGAAGG + Intergenic
996856484 5:128013752-128013774 AAGAATAAAGGTGGGGAGGAGGG + Intergenic
997155067 5:131547281-131547303 AAAAATAATAATAAAAAGGATGG - Intronic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997364158 5:133314819-133314841 AATAATAAAAATGATGATGATGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998760408 5:145425962-145425984 AATAATAATAATGATGATGAGGG - Intergenic
999721925 5:154405011-154405033 AAGAAAAATGAAGAGGAGGGAGG + Intronic
999954752 5:156688204-156688226 TAGAATAATTATTGGGAGGAGGG - Intronic
1000371504 5:160540909-160540931 AAGAATATGAAGGAGGATGACGG + Intergenic
1000560834 5:162787264-162787286 AAAAATAATAATAAAGAAGAAGG + Intergenic
1000622105 5:163497521-163497543 AAGAATGATACTGAGGAAGGAGG - Intergenic
1000673703 5:164093861-164093883 AAGAGAAAAAATGAGGAAGAGGG - Intergenic
1000847458 5:166299642-166299664 AGGGATAATAATTAGGAGGCTGG - Intergenic
1000902253 5:166925401-166925423 AAGAATAAATATGAGGACAATGG + Intergenic
1001036467 5:168300280-168300302 AAAAATAATAATGGGGTGGCGGG + Intronic
1001079411 5:168656115-168656137 AAAAATAAAAAGGAGGAGGAGGG - Intergenic
1001270546 5:170308148-170308170 AATAATAATAATAAGGAAAAAGG - Intergenic
1002178524 5:177416981-177417003 AAAAATAAAAATAAAGAGGAAGG - Intronic
1002275886 5:178104299-178104321 AAAAAAAAAAATGGGGAGGAAGG - Intergenic
1002560399 5:180077960-180077982 AAAAATAAGAAAGAGGGGGAGGG - Intergenic
1002938938 6:1699265-1699287 AAGAAGAAAAATAAGGAAGATGG + Intronic
1002944536 6:1748968-1748990 AAGTATAATAATAAGTAGAAAGG - Intronic
1002976546 6:2084176-2084198 AAGAGTATCTATGAGGAGGAAGG - Intronic
1003288420 6:4755987-4756009 AGGAGAAATAATAAGGAGGAGGG - Intronic
1003658633 6:8039283-8039305 AGGAAGTATAGTGAGGAGGAGGG + Intronic
1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG + Intergenic
1003845302 6:10167604-10167626 AAGAATAACAGTGAGAAGAAGGG + Intronic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005472615 6:26176579-26176601 AATAATAATAAAGAAGATGAGGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1007696827 6:43739439-43739461 AATAATAATAGTGATGATGACGG - Intergenic
1007870454 6:45030701-45030723 TAGAATAATTATGGGGAGTAAGG + Intronic
1008153008 6:47978106-47978128 AAGAAAAATAATGAGAAGGGGGG - Intronic
1008202739 6:48612158-48612180 AAGAAGGAAAAGGAGGAGGAGGG - Intergenic
1008328678 6:50218904-50218926 AAGAATAAGAAAGAGAAGAAAGG - Intergenic
1008459487 6:51751643-51751665 AAAAATATTAATGAAGAGTAAGG - Intronic
1008884181 6:56413643-56413665 AAGAAGATTAAGGAGGAGGTGGG + Intergenic
1008992858 6:57624233-57624255 AGGAAAGATAATGAGGGGGAAGG - Intronic
1009181476 6:60523339-60523361 AGGAAAGATAATGAGGGGGAAGG - Intergenic
1009647943 6:66432224-66432246 AAGAATGAAAGTGAGGAGCAAGG - Intergenic
1009955538 6:70448332-70448354 CACACTAATGATGAGGAGGAAGG - Intronic
1010107286 6:72184696-72184718 AAGAAAATTATTGAGGAGAAAGG + Intronic
1010140901 6:72613486-72613508 AAGATTAAAAATGAGAAAGAAGG - Intergenic
1010301434 6:74264788-74264810 AAGAATAATAGTGAAGTGGAGGG - Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010609942 6:77942260-77942282 AAGGATTACAAAGAGGAGGAAGG - Intergenic
1010669296 6:78668174-78668196 AAAAGTCATAATAAGGAGGATGG + Intergenic
1010925780 6:81744188-81744210 AAAAATCATAATGATGAGGGTGG - Intronic
1011281501 6:85682409-85682431 AAGAATAATAATAACATGGAAGG - Intergenic
1011483052 6:87814275-87814297 AAAAATAATACTAAGGAGGGAGG + Intergenic
1011514345 6:88136038-88136060 AAGGAGAGTAATGAGGATGAGGG - Intergenic
1011677768 6:89752031-89752053 AAGGATAATATTGTGGATGATGG + Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011867278 6:91845789-91845811 AAAAATAATAATAATAAGGATGG + Intergenic
1012086758 6:94836538-94836560 AAGGATTGTAATGAGGAGAAAGG - Intergenic
1012112373 6:95252728-95252750 CAGAAAAATAATTAGTAGGAAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012183508 6:96185124-96185146 AAAAATATTGTTGAGGAGGAAGG - Intronic
1012322165 6:97863109-97863131 AATAATAATAATTAGCAGCAAGG - Intergenic
1012505184 6:99937740-99937762 AAAAAAAAAAATGAAGAGGAAGG - Intronic
1012559076 6:100556521-100556543 AAGAATGTTAATCAGGAGAAAGG + Intronic
1013430662 6:110052337-110052359 AAGAAGAATAATCAGCAGCAAGG - Intergenic
1013517769 6:110904290-110904312 ACAAATAATTCTGAGGAGGAGGG - Intergenic
1013519250 6:110917447-110917469 CACACTAATGATGAGGAGGAAGG + Intergenic
1014474712 6:121858205-121858227 AACAAAGAAAATGAGGAGGATGG - Intergenic
1014476238 6:121875298-121875320 AAGTCTAATAATGAGAAGAATGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014925515 6:127266430-127266452 AAGAAAAAAAATGGGGAGGGGGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015049761 6:128825989-128826011 AAGAAAAATATTTATGAGGAAGG + Intergenic
1015609986 6:135006576-135006598 AAGAATAATGATGGAAAGGAAGG + Intronic
1015679744 6:135792593-135792615 AAGAAAAATACTGAGAATGATGG - Intergenic
1016097303 6:140054331-140054353 AAGAAGAATAATGTGTAGGATGG + Intergenic
1016497325 6:144678599-144678621 AATAAAAATAATGGGGTGGAAGG + Intronic
1016848799 6:148595347-148595369 AGGAATGACAATGAGGATGATGG - Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017218211 6:151935205-151935227 AATAATAATGATGATGATGATGG - Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017849727 6:158294704-158294726 AAGAAGAAAAAAGAGGAAGAAGG - Intronic
1017892889 6:158653959-158653981 AAGAAAAGAGATGAGGAGGATGG - Intronic
1018365173 6:163112561-163112583 AAGGAGAAAAATGAGGGGGAAGG - Intronic
1018371714 6:163174765-163174787 AACAATAATGATGATGATGATGG - Intronic
1018389342 6:163330554-163330576 AAGGAAAATAATGAGGAAGATGG - Intergenic
1018996575 6:168714884-168714906 GAGAATGATGATGAGGAGGAGGG + Intergenic
1018996717 6:168715822-168715844 GAGAATGATGATGAGGAGGATGG + Intergenic
1020053194 7:5096998-5097020 AAGTAGAATAATGAGGCGGGTGG - Intergenic
1020126150 7:5533404-5533426 AATAATAATAAAAAGGAGGTTGG - Intronic
1020264180 7:6549394-6549416 AAGATTAAGAATGAGGAGCCTGG - Intronic
1020757623 7:12223483-12223505 AGAAATAATAATGATGGGGAAGG - Intronic
1020870483 7:13623173-13623195 TAGAATAATAATAACAAGGAGGG - Intergenic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1020967192 7:14886020-14886042 AAAATTGATAGTGAGGAGGATGG + Intronic
1021032453 7:15754547-15754569 AAGGATAATAAGGAGGATCATGG - Intergenic
1021508859 7:21413863-21413885 AAGGATGATGATGAAGAGGAGGG + Intergenic
1021584435 7:22193021-22193043 AAGAAATACAAGGAGGAGGAGGG - Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021866133 7:24960252-24960274 TAGAAGACTAATGAGGTGGAAGG - Intronic
1022018923 7:26379497-26379519 AAAAATAAGAATGAAGAGGGGGG - Intergenic
1022037809 7:26550568-26550590 AAGAAAAATGAGGAGGAAGAGGG + Intergenic
1022368559 7:29749418-29749440 AAGAAAAAAAAACAGGAGGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022828959 7:34045515-34045537 AAGAATGAGAATGAGGGGGCAGG + Intronic
1023180696 7:37480445-37480467 AAAAATAATAATGGAGAGGAAGG + Intergenic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023279899 7:38558568-38558590 AGGAATAATGATGGGAAGGAGGG + Intronic
1023372926 7:39530073-39530095 AAGGAGAGTAGTGAGGAGGACGG + Intergenic
1023386591 7:39664031-39664053 AAGAAAAACATTGAGGAGAAAGG + Intronic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1024142757 7:46478954-46478976 AATAATAATAATGTGGAAAAGGG - Intergenic
1024237455 7:47409087-47409109 ACAGAAAATAATGAGGAGGAAGG + Intronic
1024318392 7:48042522-48042544 AAAAATAATAATGAGAGAGAGGG + Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025102294 7:56145567-56145589 CACACTGATAATGAGGAGGAAGG + Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1025791166 7:64688247-64688269 AAAAAAAAAAAAGAGGAGGAAGG - Intronic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025955499 7:66179603-66179625 AAGAATAAGAGTGAGTAGGCCGG + Intergenic
1025970493 7:66319938-66319960 GAGAAAAGTAAAGAGGAGGAGGG - Intronic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026256636 7:68717750-68717772 GAGAATAATAAAGATGAAGAAGG - Intergenic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1026508455 7:71006950-71006972 AATAAGAAGAAAGAGGAGGAAGG - Intergenic
1026733481 7:72932238-72932260 AAAAATAAAAATGGAGAGGAAGG - Intronic
1026783766 7:73286792-73286814 AAAAATAAAAATGGAGAGGAAGG - Intergenic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1027110554 7:75435389-75435411 AATAATAAAAATGGAGAGGAAGG + Intronic
1027609634 7:80344208-80344230 TATAATAATAATGATGATGATGG - Intergenic
1028152247 7:87387653-87387675 AAGAAAAATCATAAGGAGGCTGG + Intronic
1028213016 7:88098661-88098683 AGGAATAAAAGTGATGAGGAAGG - Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028713460 7:93937283-93937305 AATAATAATCATGATGATGATGG - Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029939271 7:104462774-104462796 GACAAAAAAAATGAGGAGGAGGG - Intronic
1030310493 7:108064145-108064167 ATGAATAATAATGAAAATGAAGG - Intronic
1030394802 7:108972451-108972473 AAAAATGAAAAAGAGGAGGAAGG + Intergenic
1030458749 7:109805291-109805313 AAGAAAAACAATGAGGGAGATGG + Intergenic
1030512232 7:110496956-110496978 AAAAAAAAAATTGAGGAGGAGGG - Intergenic
1030788242 7:113689667-113689689 GAGAAAAACAATGAGGATGAAGG + Intergenic
1030788396 7:113692011-113692033 GAGAAAAACAATGAGGATGAAGG - Intergenic
1030954712 7:115837864-115837886 AATAATAATAATCCAGAGGATGG - Intergenic
1031247607 7:119336874-119336896 AATAATATTAATGAAGATGATGG - Intergenic
1031370367 7:120958189-120958211 AAAAATAATAAAAAGGAAGAGGG - Intronic
1031537699 7:122955731-122955753 AATAAGAATAATGAAGTGGAAGG + Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032103615 7:129005232-129005254 AAGTATAATAATGAGAAAGATGG + Intronic
1032214376 7:129946040-129946062 AAAAATAATAATGACTAGGCTGG - Intronic
1032365948 7:131300243-131300265 AAGAATGACAATGACGAGGTTGG + Intronic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1032819246 7:135509743-135509765 AAGAAGACCAAGGAGGAGGAGGG + Intronic
1032885377 7:136132725-136132747 TAGAATAATCATGATGATGAAGG - Intergenic
1032906446 7:136372852-136372874 GAGAAAAATAATGTGGAGAAAGG - Intergenic
1032987036 7:137349002-137349024 AAGAAAAAAAATGAGAAGGAGGG + Intergenic
1033085190 7:138334903-138334925 AAGAAAATTATTGAGGAGAAAGG + Intergenic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033735569 7:144218328-144218350 AAGAATAAAGATGAATAGGAAGG + Intergenic
1033747485 7:144332642-144332664 AAGAATAAAGATGAATAGGAAGG - Intergenic
1033832619 7:145271695-145271717 AAGAAGAATAAGCAGGAAGAAGG + Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035731666 8:1857983-1858005 AATAATAATGAAGAGGAAGAGGG + Exonic
1035935060 8:3827718-3827740 AAGAAGTACAATGAGGTGGATGG - Intronic
1036277843 8:7371486-7371508 AATAATAATAATAAAGGGGAGGG + Intronic
1036343680 8:7940406-7940428 AAAAATAATAATAAAGGGGAGGG - Intronic
1036441619 8:8787062-8787084 AATAATAATACTGAGTAAGATGG - Intronic
1036792232 8:11728797-11728819 TAGATTAATACTGAGAAGGAAGG - Intronic
1036991431 8:13601097-13601119 AATAATATTAATGGGGACGAAGG - Intergenic
1037016562 8:13914791-13914813 AATAATAATAATAATCAGGAGGG + Intergenic
1037076448 8:14725566-14725588 AATAAAAATAATGAGAAGCAAGG + Intronic
1037207307 8:16338508-16338530 AAGACTAATAAAGAGGAGAGAGG - Intronic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038152780 8:24957177-24957199 AAGAAAAATAATCAGGAGAAAGG - Intergenic
1038197710 8:25383175-25383197 TATAATAATAATGACAAGGATGG + Intronic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038892598 8:31743244-31743266 AAGAATAATATTCTGCAGGAGGG + Intronic
1038981601 8:32765556-32765578 AAGAAAAATAAGGGGGAGAAAGG - Intergenic
1039129519 8:34247510-34247532 AAAAAAAAAAATGTGGAGGAGGG - Intergenic
1039134795 8:34309389-34309411 AATAATAATAATAAAGGGGATGG + Intergenic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039691671 8:39871092-39871114 CACACTAATGATGAGGAGGAAGG + Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040095910 8:43442340-43442362 AGGAAAAATAACGAGGAGAAGGG - Intergenic
1040730130 8:50434742-50434764 AAAAGGAATAATGAGGATGATGG - Intronic
1040759040 8:50815336-50815358 AAGAATGAAAACGTGGAGGAAGG - Intergenic
1041068983 8:54108022-54108044 AATAATATTAATAAAGAGGATGG - Intergenic
1041115950 8:54537031-54537053 AAGAAGAATAAGGTGGAAGAAGG - Intergenic
1041554420 8:59136706-59136728 AAGAAAAGAAATGAGGAGGGAGG + Intergenic
1041847186 8:62343047-62343069 AATAATAATAATGATGAAAAAGG - Intronic
1041898448 8:62954117-62954139 AATAATAATAATGATGATGTTGG - Intronic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043021205 8:75002496-75002518 AAAAATAATAATAATGATGAAGG + Intronic
1043344387 8:79282895-79282917 AACAAAAATAATGATGATGAGGG - Intergenic
1043581415 8:81720461-81720483 AACAATAATAATGAGAATCAGGG + Intronic
1043672275 8:82901893-82901915 GAGAATAATAATTAAGAGTATGG + Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043727869 8:83633957-83633979 AAGAAAAAAAAAGAGGAGGAAGG - Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044584374 8:93855961-93855983 AAGAATGATGAGGAAGAGGATGG - Intergenic
1044784035 8:95775839-95775861 AAAAATAATAATGAGGAGGTTGG + Intergenic
1044818317 8:96135864-96135886 AAAAATAATAATAATGATGATGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044970174 8:97611983-97612005 AAGAATATTAATGAAGTGGCCGG + Intergenic
1045132890 8:99176997-99177019 AAGAAAATTATTGAGGAGAAAGG + Intronic
1045316665 8:101049308-101049330 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1046080020 8:109360831-109360853 TAGAATAATAATCAGTAAGATGG + Intergenic
1046141317 8:110096676-110096698 AAGAAGAAGAATCAGAAGGAGGG + Intergenic
1046145789 8:110156701-110156723 GAGAAAAATGATGAGGAGAAAGG - Intergenic
1046286981 8:112106981-112107003 AAGAAGAAAAATGAAGAGGAAGG + Intergenic
1046350577 8:113005634-113005656 CATAATGAAAATGAGGAGGATGG - Intronic
1046476362 8:114749868-114749890 AAGAAAAAAAAATAGGAGGAGGG - Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047518689 8:125577790-125577812 AAGAAGAGAAAGGAGGAGGAAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047626041 8:126657109-126657131 AAGAGTAAGAATGAGGATGCTGG - Intergenic
1047731669 8:127733964-127733986 AAGAATAACAAGGAGGTGGCTGG + Intergenic
1047887171 8:129264493-129264515 AAGGAAAATAATGAGGACAAAGG + Intergenic
1048039211 8:130709176-130709198 GAGAATTAGAATGAGGAGGGTGG + Intergenic
1048185556 8:132237242-132237264 AAGAGTAATGATGATGATGATGG + Intronic
1048529081 8:135231198-135231220 AAGGATAATAGTGAAGAGGGAGG - Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048813362 8:138308579-138308601 AAGAATAATTATGATGAAGTTGG - Intronic
1049036442 8:140079950-140079972 AATAATAAAAATGAAGAAGAAGG + Intronic
1050183365 9:2944049-2944071 GAGAATAATAATGTGATGGAAGG - Intergenic
1050990139 9:12139749-12139771 AAGGAAAAAAATGAGGAGGTGGG + Intergenic
1051237382 9:15015803-15015825 GAGAATAATAATGAAAAGAATGG - Intergenic
1051239780 9:15041443-15041465 CAGAATAATCATGAGGACAAAGG + Intergenic
1051302146 9:15663455-15663477 AAGAATAAAAATAAGCAGGCAGG - Intronic
1052073857 9:24116959-24116981 CAGAATAAAAATGTGGAGAAGGG - Intergenic
1052510414 9:29411493-29411515 AAGGATAATAATGGGGAGATGGG - Intergenic
1052613583 9:30809101-30809123 AAAAATGGTAATGAGGAGGAAGG + Intergenic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1055227659 9:74019258-74019280 AAAAATAAAAAAGAGGAGAAGGG + Intergenic
1055249575 9:74286938-74286960 AAAAATAATGAGGGGGAGGATGG - Intergenic
1055652025 9:78415499-78415521 AAATAGAATCATGAGGAGGATGG + Intergenic
1055712333 9:79076785-79076807 AATAATAATAATAAAAAGGAAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056009902 9:82317043-82317065 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056688118 9:88783536-88783558 AAGAAGAAAATGGAGGAGGAGGG + Intergenic
1056695124 9:88842128-88842150 AAAAATAATAATGAGGATGATGG - Intergenic
1057405030 9:94761984-94762006 AACTAGAATAATGAGGAAGAAGG + Intronic
1057613216 9:96566143-96566165 AAGAATGGTAATGAGTAGTAAGG + Intronic
1058735737 9:107892401-107892423 AAGAATCATAAAGAAGAGGCTGG + Intergenic
1058808935 9:108620286-108620308 AAGAAGGAAAAGGAGGAGGAGGG + Intergenic
1059571594 9:115443345-115443367 AAGAATAGTCATGAAGAGCATGG + Intergenic
1059586852 9:115616525-115616547 AAGAATAAAACTGAGGCTGAAGG + Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059811410 9:117859523-117859545 AAGATGAAGATTGAGGAGGATGG + Intergenic
1059918316 9:119129117-119129139 AATAAGAATGAGGAGGAGGAGGG + Intergenic
1059930489 9:119255557-119255579 AGGACTAATAAAGAGGATGAAGG - Intronic
1060272312 9:122153719-122153741 AAAAGGAAGAATGAGGAGGATGG - Intronic
1060478793 9:124005160-124005182 AAGAATAAAAATGTTGGGGAGGG + Intronic
1061053222 9:128208035-128208057 AAAAAAAAGAATGGGGAGGAAGG - Intronic
1061311502 9:129766246-129766268 AATAATAATAAGGCAGAGGAAGG - Intergenic
1061722031 9:132557752-132557774 AAGAAAAGAAATGAGGAGGCCGG - Intronic
1061769596 9:132908100-132908122 AATAATAATAATGAGAAAGTTGG + Intronic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203616242 Un_KI270749v1:68534-68556 AAGAAAAGTAAAGAGGAGGAGGG - Intergenic
1185814053 X:3137759-3137781 AATAATAATAATAAGGCGGAAGG - Intergenic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186125470 X:6409214-6409236 AATAAAAACAATGAAGAGGATGG - Intergenic
1186572244 X:10727413-10727435 AAAAATCATAATGATGAGGCTGG - Intronic
1187005197 X:15225894-15225916 AATATTAATTAGGAGGAGGAGGG + Intergenic
1187264586 X:17719142-17719164 AGGAATAATAAGGAGAAGGAAGG + Intronic
1187330228 X:18331748-18331770 AAGAATAAAAACGAGAAGAAAGG - Intronic
1188002945 X:24999102-24999124 AAGAAGTATATTGAGGAGCATGG - Intergenic
1188228381 X:27630340-27630362 CAGAATAATAATGAGTAAGGAGG + Intronic
1188440197 X:30208901-30208923 AAGACTCATAATGAGGGGCAAGG + Intergenic
1188495410 X:30778351-30778373 TAGAACAATAAAGTGGAGGAAGG + Intergenic
1188723236 X:33548807-33548829 AAAAAAAAAATTGAGGAGGAGGG - Intergenic
1188738881 X:33752668-33752690 AAAAAAAAAACTGAGGAGGAAGG - Intergenic
1189051436 X:37649871-37649893 AATAATAATGATGAAGACGAGGG - Intronic
1189468309 X:41294858-41294880 AAGAAAAAAAATGAGATGGAGGG + Intergenic
1190067279 X:47250017-47250039 AAGAATAATAATCCAGAAGAAGG + Intergenic
1190623387 X:52311706-52311728 AACAACAATAATGAGGATTAAGG - Intergenic
1190750433 X:53357342-53357364 GAGGATCATTATGAGGAGGAGGG + Intergenic
1190751907 X:53369491-53369513 AAAAACAAAAATCAGGAGGAGGG + Intergenic
1190801635 X:53794797-53794819 GAGGATCATTATGAGGAGGAGGG + Intergenic
1190933676 X:54973227-54973249 AAGACTAATAAAGAGGAAAAGGG - Intronic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191598189 X:62971250-62971272 AGGAAAAAAAATGAGGAGAAGGG + Intergenic
1191610884 X:63111757-63111779 CCGAAAAAAAATGAGGAGGAAGG + Intergenic
1191976746 X:66880895-66880917 AAGAATACAAATGATGAGCAAGG + Intergenic
1192033137 X:67536279-67536301 AATAATACAAATGATGAGGAGGG - Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192843892 X:74885401-74885423 AAGAATAATAAAGAAGAAAAGGG + Intronic
1193578034 X:83227991-83228013 AAAAATAATAAGAAGAAGGAGGG - Intergenic
1193581390 X:83267785-83267807 AAGAATGTTAATGAGCAAGAAGG + Intergenic
1194101073 X:89704792-89704814 AACAAAAACAATGAGGAAGAGGG - Intergenic
1194520329 X:94910085-94910107 AAAAAAAAAATTGAGGAGGAGGG + Intergenic
1194547721 X:95258363-95258385 AAGACTCAGAATGGGGAGGATGG - Intergenic
1195400203 X:104453454-104453476 AAGAAAAAAAAAGAGGAGCAAGG - Intergenic
1195674836 X:107500080-107500102 AAGAATAATAAAGAGGAAAATGG - Intergenic
1196274344 X:113749516-113749538 AAACATAATAATGAGGACAATGG + Intergenic
1196992048 X:121340802-121340824 AAGAAGCCTAGTGAGGAGGAAGG - Intergenic
1197167725 X:123396224-123396246 AATAATAATAATGATGATAAGGG + Intronic
1197280982 X:124535589-124535611 AATAAGAATAATGAGGATGGAGG - Intronic
1197606091 X:128587490-128587512 AAAAAAAAAAAGGAGGAGGAAGG - Intergenic
1197664839 X:129212410-129212432 AAGAATTATGAGGAAGAGGAAGG + Intergenic
1198094141 X:133361833-133361855 AAGAGAAAGAATGAGGAGGCAGG + Intronic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198699118 X:139377709-139377731 AAGAAAAATATAGAAGAGGAGGG - Intergenic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1198852541 X:140980497-140980519 AAGAAGAATAATGAAGAGGAAGG - Intergenic
1198910750 X:141611184-141611206 AATAATAATAATAAGGAGGTAGG - Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200139156 X:153889647-153889669 AAAAATAATAAAGTGGAGGTGGG - Intronic
1200295933 X:154920441-154920463 AATAATAATATGTAGGAGGAAGG - Intronic
1200454027 Y:3365876-3365898 AACAAAAACAATGAGGAAGAGGG - Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201684060 Y:16681902-16681924 CACACTAATGATGAGGAGGAAGG - Intergenic