ID: 1048562949

View in Genome Browser
Species Human (GRCh38)
Location 8:135562179-135562201
Sequence CACTTACCATGAGTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048562949 Original CRISPR CACTTACCATGAGTGGAACT TGG (reversed) Intronic
903480142 1:23647090-23647112 CACTTACCAGCAGTGTGACTTGG + Intergenic
905838024 1:41146480-41146502 CACTTACCTTGAATGGAGCTTGG - Intronic
907215158 1:52857158-52857180 CACTTATGATGTCTGGAACTGGG - Exonic
911032786 1:93508019-93508041 CACTTCTCAGGAGAGGAACTGGG - Intronic
915018274 1:152757136-152757158 CATTTACCCTGAGTGGATTTGGG + Intronic
916284498 1:163090689-163090711 CACTTACTGTGAATGGAGCTTGG + Intergenic
916623012 1:166522002-166522024 CATTGAGCATGAGTGGAAATTGG + Intergenic
917794668 1:178524299-178524321 CACTTAAGAGGAGAGGAACTGGG - Intronic
918258862 1:182775901-182775923 CATTTACCATGAGTAGATGTAGG - Intergenic
919144500 1:193616693-193616715 CATTTACCATGAATGGAAGTTGG - Intergenic
922479979 1:225933237-225933259 CACTTGCCATGAATGGAGCTTGG + Intergenic
922587059 1:226741651-226741673 CACTTACCAGCAATGGAATTTGG - Intergenic
923448486 1:234094594-234094616 GTCTAACCATTAGTGGAACTAGG + Intronic
923643062 1:235785221-235785243 CACTTACGATGGGTGGATCAGGG - Intronic
1065194265 10:23247256-23247278 CACTTACCATGAATGGAGCATGG - Intergenic
1069793538 10:71038691-71038713 CACTTCCCATCAGAGAAACTTGG + Intergenic
1070383316 10:75901206-75901228 CACTTACCATCAATGGAAGTGGG + Intronic
1070642969 10:78182263-78182285 CACTTACCGTGGCTGGCACTGGG - Intergenic
1072647271 10:97266850-97266872 CACATGTCATGAGAGGAACTCGG - Intronic
1073855078 10:107664197-107664219 CACATGCCATGGGAGGAACTCGG - Intergenic
1074690923 10:116003382-116003404 CACTTAGCATGTGTGGACTTTGG + Intergenic
1082748597 11:56995004-56995026 CACTTGTCATGAGAGGAACCCGG - Intergenic
1084509331 11:69593481-69593503 CACTTACTGTGCATGGAACTGGG - Intergenic
1085912524 11:80844854-80844876 CACTTGTCATGATTGGAAGTGGG - Intergenic
1087180106 11:95133587-95133609 CACTTACCATGCTTGGCACATGG + Intergenic
1087526898 11:99326080-99326102 CACTTATTTTGAGTGAAACTGGG + Intronic
1087560247 11:99781434-99781456 CACTTAGTATGAGAGGAGCTTGG - Intronic
1091026548 11:132146685-132146707 CATTTTCATTGAGTGGAACTAGG + Intronic
1093147724 12:15586780-15586802 TACTGACCAGGAGTGGAACGTGG + Intronic
1093680835 12:22000691-22000713 CACTTACCATGAATGAACTTTGG + Intergenic
1096800572 12:54107673-54107695 CACTTACTTGGGGTGGAACTGGG - Intergenic
1103764026 12:123269444-123269466 GAGTGACCAGGAGTGGAACTCGG - Intronic
1104179440 12:126364457-126364479 CACTGACCATGATTGGACCATGG - Intergenic
1106425142 13:29621543-29621565 CACTTACCATGAATGGAACTTGG + Intergenic
1107046058 13:35993536-35993558 CACTTACTATCTGTGAAACTTGG + Intronic
1108340157 13:49491380-49491402 CATTTATCCCGAGTGGAACTGGG - Intronic
1108522839 13:51260651-51260673 CACTTACCATCTGTAGTACTGGG - Intronic
1110734199 13:78915987-78916009 CACCTACCATGAATAGATCTGGG - Intergenic
1111254113 13:85642846-85642868 TACATACCATTATTGGAACTTGG + Intergenic
1112642506 13:101291914-101291936 CCCTCACCATCAGTGGACCTTGG - Intronic
1116868066 14:50047402-50047424 CACTTTCCATGAATGGTTCTGGG - Intergenic
1117456375 14:55901198-55901220 CACATACAATGAGAGGAATTGGG + Intergenic
1118616759 14:67579302-67579324 GACTTACCATGTGAGGAGCTGGG + Exonic
1122027963 14:98891475-98891497 CAGTTCACATCAGTGGAACTGGG + Intergenic
1124235631 15:27987357-27987379 CAGTCACCATGTGTTGAACTTGG + Intronic
1125002982 15:34790781-34790803 CACTTACCTAGAGTGTAATTTGG + Intronic
1126477554 15:49081612-49081634 CACTTATTATGATTGGATCTAGG - Intergenic
1126549339 15:49909310-49909332 CACTTACCACCCGTGGACCTGGG + Intronic
1128425096 15:67535149-67535171 CACTTACCATGCGTGGCCTTGGG - Intergenic
1129612538 15:77071895-77071917 CACTTACTATGTGTGGCTCTGGG - Intronic
1129830993 15:78670098-78670120 CACTTACAGCAAGTGGAACTTGG + Intronic
1138489954 16:57371122-57371144 CTCTGAGCATGAGTGGACCTTGG + Intergenic
1144713453 17:17418534-17418556 CATTTACCATGAGTGGTTCAAGG - Intergenic
1144716695 17:17441123-17441145 CAATCACCATGAGTGGAAGGTGG - Intergenic
1146386161 17:32375894-32375916 CAGTTAGCATAAGTGGAATTGGG - Exonic
1146643562 17:34560446-34560468 CACTTACCATGAATGGCATGTGG - Intergenic
1146909802 17:36641463-36641485 CCCTTCCCATGAGTGGAGCCGGG + Intergenic
1151349740 17:73524741-73524763 CACTGACCATGTGTGTAACCTGG - Intronic
1156517221 18:37690771-37690793 CACTTAGCATGAATGAAGCTCGG - Intergenic
1157107368 18:44787157-44787179 AACTGAGCATGAGTGGAACTAGG + Intronic
1158784994 18:60700577-60700599 CATTTACTATGTGTGGAACAGGG + Intergenic
1163712127 19:18853151-18853173 CACTTTACAAGGGTGGAACTAGG - Intronic
1165195788 19:34102157-34102179 TACTTCCCATGAATGGAGCTTGG - Intergenic
1167860039 19:52275592-52275614 CACTTACCATGAATGGAGCTTGG - Intronic
925426452 2:3752480-3752502 CACTAACCAAGAGTGTAACATGG + Intronic
927674995 2:25098804-25098826 TACTTACCAGGAGTGGAAAGTGG - Intronic
928221947 2:29410748-29410770 CACTTGCCATGAATGAACCTTGG + Intronic
929052432 2:37849455-37849477 CATCTACCATGAGTAGAAGTAGG + Intergenic
932226008 2:70041362-70041384 CACGTACCAGGAATGGAAGTTGG - Intergenic
932374524 2:71223735-71223757 CACTTACCATAAGTCAGACTCGG - Intronic
933906028 2:86893360-86893382 CACCTACCATAACTGGAGCTGGG - Intergenic
935403367 2:102683408-102683430 CAAGAACCACGAGTGGAACTGGG + Exonic
935766871 2:106376530-106376552 CACCTACCGTAAGTGGAGCTGGG - Intergenic
936035827 2:109110368-109110390 CATCTACCATCATTGGAACTTGG + Intergenic
937980892 2:127614706-127614728 CACTTACAGGGAGTGGAAATGGG + Intronic
938847924 2:135230645-135230667 CACTTTCCACGAGTGGAGTTCGG + Exonic
942504397 2:176626438-176626460 CACCTCCCATGTGTGGGACTCGG + Intergenic
942801910 2:179884915-179884937 CAGTTACCATGATTTAAACTAGG - Intergenic
944516697 2:200519691-200519713 CGCTTACCATGAATGGGGCTTGG + Intronic
948893977 2:240919767-240919789 CAGTTAACATGAGAGGAAGTGGG + Intronic
1169668762 20:8071057-8071079 CTCTTATCATGGGTGGAAATAGG + Intergenic
1170253319 20:14311187-14311209 CACTTACCACAAATGGAGCTTGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1177065402 21:16427307-16427329 CACTTACTAGCACTGGAACTTGG - Intergenic
1184982155 22:48102469-48102491 CACTTGCCATGGGAGGAACCCGG - Intergenic
949975234 3:9451324-9451346 CACTTACCATGCATGAAATTGGG + Intronic
953384882 3:42500935-42500957 CCCTTGCCATGAGGGGAACTTGG - Intronic
954221492 3:49157491-49157513 CACTTACCATGAATGGCACTTGG - Intergenic
955882008 3:63556726-63556748 CACTTACAATGAGTGGGCCCCGG - Exonic
956575316 3:70746239-70746261 CATTTTCCATGTGTGCAACTAGG - Intergenic
961119189 3:124358988-124359010 CTCTTTCCATGTGTGGATCTGGG + Intronic
967933639 3:194708899-194708921 CACTTACCAACAGCGGACCTTGG + Intergenic
976327100 4:83784161-83784183 CACATACCATGAATGGACATAGG + Intergenic
982252346 4:153419966-153419988 CACTTATCATGAGAGGGACCCGG - Intergenic
987663029 5:20902139-20902161 AGCTTACCATGAGCAGAACTTGG - Intergenic
988186846 5:27875118-27875140 CACTTACAATAAATGGAGCTTGG - Intergenic
988268865 5:28988031-28988053 CACATACCATTACTGGAAATTGG + Intergenic
988759656 5:34300044-34300066 AGCTTACCATGAGCAGAACTTGG + Intergenic
990744792 5:58948849-58948871 AACTTACCTTGACAGGAACTAGG - Intergenic
991065399 5:62419218-62419240 CACTTACCTCGAATGGAGCTTGG + Intronic
991708101 5:69379310-69379332 AACTTACCATGAATGGAGCTTGG + Intronic
992201920 5:74393309-74393331 GACATATCATGAGTGGACCTGGG - Intergenic
992945092 5:81802118-81802140 CAGATACCTTGAGTGGGACTGGG - Intergenic
993196613 5:84756695-84756717 TACTTGCTGTGAGTGGAACTAGG + Intergenic
993480352 5:88416954-88416976 CACTTACTAGATGTGGAACTTGG - Intergenic
996974037 5:129408929-129408951 CATTTAACTTGAGTGGAATTTGG - Intergenic
997363485 5:133310539-133310561 CAGTTCCCATGAGTGGGTCTGGG - Intronic
998744683 5:145244637-145244659 TACTTACTATGAGTTGAAATTGG - Intergenic
999179237 5:149657247-149657269 CACTTTCCCTTAATGGAACTGGG - Intergenic
999841297 5:155430528-155430550 CACTTGCCATGGGAGGAACCCGG + Intergenic
1001225210 5:169938579-169938601 CACTTGCCATGAATGGAGCTTGG + Intronic
1002566974 5:180117622-180117644 CACATGCCATGAGTAGAATTTGG + Intronic
1003216527 6:4118390-4118412 CACATACCCTGAATTGAACTTGG - Intronic
1007559194 6:42792074-42792096 CAGTTACCATGAATGAAGCTTGG + Intronic
1008062713 6:47015354-47015376 TTCTTATCATGATTGGAACTAGG + Intronic
1014142345 6:117958469-117958491 AACCTACCATGAATGGAACTTGG - Intronic
1015721203 6:136244264-136244286 CACCTACCATGAATGGAAGATGG - Intronic
1018624424 6:165764106-165764128 CTGTTACCAGGAGTGGAGCTTGG - Intronic
1019193025 6:170264678-170264700 CACTTGCCATGAATGAAGCTTGG + Intergenic
1034656318 7:152732195-152732217 CACTTTCCATCAGTGGCACATGG - Intergenic
1034926678 7:155128317-155128339 CACATACCATGAGAGGGACCTGG + Intergenic
1039156992 8:34571718-34571740 TACTGACCATGAATGGAGCTTGG - Intergenic
1039396927 8:37234399-37234421 CAGTTACCAAGAGAGGCACTAGG + Intergenic
1043061509 8:75510490-75510512 CACCTACCATGAAGGGAACTTGG - Intronic
1043099583 8:76024538-76024560 TACTTACCAAAAGTGGAATTTGG - Intergenic
1044244264 8:89923042-89923064 CGCTTACCATGAATGGAGCTTGG + Intronic
1048562949 8:135562179-135562201 CACTTACCATGAGTGGAACTTGG - Intronic
1049264269 8:141658981-141659003 CACTGTCCATGAGGGGATCTTGG - Intergenic
1049350272 8:142160637-142160659 CCCTCACCTTGAGTGGATCTCGG - Intergenic
1056224774 9:84484071-84484093 CACTTTCTAGGAGTGGACCTGGG + Intergenic
1057116393 9:92526904-92526926 TACTTACCATGAATGGAGCTTGG - Intronic
1059850655 9:118335138-118335160 CCCTTCCCATGAGAGGAAATGGG + Intergenic
1060421241 9:123471235-123471257 CACTTAACATGTCTGGAACGTGG + Intronic
1186436297 X:9545824-9545846 CACTATCCATGAGTACAACTTGG - Intronic
1186527500 X:10262573-10262595 CACATATCATGAATGAAACTAGG - Intergenic
1188772513 X:34170894-34170916 CACTGATCATGAATGGAGCTTGG - Intergenic
1188809099 X:34630405-34630427 AATTTACCATGAGTTCAACTGGG - Exonic
1189063326 X:37778213-37778235 CACTTACCATGAGTAGAGCTTGG + Intronic
1189692046 X:43626904-43626926 CACTTCCTTTGAGTGGTACTTGG + Intergenic
1189916997 X:45865115-45865137 CACATACCATGTTTGGCACTTGG + Intergenic
1194957952 X:100203058-100203080 GACTTTCCCTGAGGGGAACTTGG + Intergenic
1195613612 X:106895472-106895494 CACTTACCATTAATGTAACCTGG + Intronic
1196664703 X:118304369-118304391 CACTTATCATGGGAGGAACCCGG - Intergenic
1201892155 Y:18954395-18954417 CTCAAACCATGAGTGGAGCTTGG + Intergenic