ID: 1048564609

View in Genome Browser
Species Human (GRCh38)
Location 8:135582046-135582068
Sequence CTCCATAAGTCTCTTGTGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048564609_1048564611 -7 Left 1048564609 8:135582046-135582068 CCCGACACAAGAGACTTATGGAG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1048564611 8:135582062-135582084 TATGGAGAATATGTAAGTGAAGG 0: 1
1: 0
2: 2
3: 25
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048564609 Original CRISPR CTCCATAAGTCTCTTGTGTC GGG (reversed) Exonic
902542833 1:17166648-17166670 CTCCCTAAGCCTCTGGTCTCAGG + Intergenic
905856470 1:41317874-41317896 CTTCTTAATTCTCTTGTTTCTGG - Intergenic
905890921 1:41517895-41517917 CTCCAAAAGGCCCATGTGTCAGG + Intronic
908010664 1:59773874-59773896 ATCCATATGTGTCTTCTGTCTGG - Intergenic
909160066 1:72135454-72135476 GTCCCTAAATCTCATGTGTCTGG - Intronic
912452991 1:109778792-109778814 CTCCATTTGTCTCCTCTGTCTGG + Intergenic
919517628 1:198546661-198546683 CTTCATAATTATCTTGTGTGTGG + Intergenic
920663253 1:207937732-207937754 CTTGATAAGTCTTTTGTCTCTGG + Intergenic
921494267 1:215818274-215818296 TTACTTAAGTCTCTTTTGTCAGG + Intronic
921589416 1:216986124-216986146 CTCCACATGTCTCTTGGGTTGGG + Intronic
922688404 1:227666365-227666387 CTGCATTAATCTATTGTGTCTGG + Intronic
924045207 1:240022156-240022178 CTACATACCTCTCTTGTCTCAGG + Intronic
1070374092 10:75812159-75812181 CTTCATATGTCTTTTGTATCAGG + Intronic
1070572896 10:77654552-77654574 CTCCTAAAGTCTATTTTGTCTGG - Intergenic
1077552681 11:3208185-3208207 ATCCAGAAGCCTCTTGTTTCAGG - Intergenic
1094342961 12:29433215-29433237 TTCCATAATCCTCATGTGTCTGG + Intronic
1101157405 12:101940750-101940772 CTCTGTAAGTCTCTTGTGTTTGG - Intronic
1101157407 12:101940773-101940795 TACCTTAAGTCTCTTGTGTTTGG - Intronic
1103283993 12:119785051-119785073 CTACCTAGGTCTGTTGTGTCGGG - Exonic
1103501251 12:121404352-121404374 CCCTATACTTCTCTTGTGTCTGG + Intronic
1103556263 12:121768560-121768582 CTCCAGAACTCTCTTGGGACTGG - Intronic
1103984964 12:124760904-124760926 CTCCATACGCCTCTGGCGTCAGG - Intergenic
1105560673 13:21487830-21487852 CTCTTTAAATCTCTTGTGGCTGG + Intergenic
1111998413 13:95187927-95187949 CTCCAGAAGTTTCTGGTATCTGG - Intronic
1115004568 14:28467140-28467162 CTCCATATGTATGTTGTGTATGG + Intergenic
1115063989 14:29232420-29232442 CTCCATAAGTTACTAATGTCAGG + Intergenic
1120471430 14:84930159-84930181 TTCCATAAATCTCTTGTCTTTGG + Intergenic
1124399850 15:29338586-29338608 CTCCATAGGGCACTGGTGTCTGG + Intronic
1128209424 15:65884726-65884748 ATACTTAAGTCTCTTGTGGCTGG + Intronic
1129408710 15:75337051-75337073 CTCCATAATTTCCTTGTGTGAGG + Intronic
1130679230 15:85981679-85981701 TTCCATAAGGCTCTTCTGTAAGG + Intergenic
1137682443 16:50361852-50361874 CTCCATAATCCTCTGGTGTGTGG + Intronic
1137996419 16:53219556-53219578 AACCAGAAGACTCTTGTGTCAGG + Intronic
1139250914 16:65495073-65495095 CTACATAATTCTCTTTTGTTTGG - Intergenic
1139515292 16:67449155-67449177 GCCCATATTTCTCTTGTGTCAGG - Intronic
1140357763 16:74320696-74320718 CCCCATAAGTATCTGGGGTCTGG - Intergenic
1142717529 17:1755198-1755220 CTCCTTAAGGCTCTTTTGTAAGG + Exonic
1150644802 17:66971299-66971321 CTCCACAAGGCTCTTCTGGCTGG - Intronic
1150740227 17:67773381-67773403 CTCAATAGTTCCCTTGTGTCCGG - Intergenic
1151230995 17:72685004-72685026 CACCATTTGTATCTTGTGTCTGG - Intronic
1151909770 17:77074614-77074636 TCACATAATTCTCTTGTGTCGGG - Intergenic
1151999271 17:77635230-77635252 CTCCTTAAGTCCCCAGTGTCCGG + Intergenic
1156702547 18:39842284-39842306 CTCCATAAGTCTCCTCTTTCCGG - Intergenic
1157893509 18:51441752-51441774 TTGCAAAATTCTCTTGTGTCTGG - Intergenic
1159209687 18:65301501-65301523 CTCCATAAGTTTCAAGTGTTAGG - Intergenic
1167374953 19:49105894-49105916 CTGGATGAGTCTCTTGTTTCGGG + Intronic
937735567 2:125283789-125283811 CTGCATATGTCTCTTGTTTTTGG + Intergenic
941770570 2:169340924-169340946 CTCCTCTGGTCTCTTGTGTCTGG - Intronic
943704745 2:191022598-191022620 CTCCACAACACTCTTATGTCAGG - Intergenic
945246158 2:207718948-207718970 CTCCATAATTCTCCTCTGTGTGG - Intronic
945943990 2:215976631-215976653 CTCCATAAGTGTCAGTTGTCGGG + Intronic
1175713202 20:61237586-61237608 CTCCATAAGTATGTTGTGTTGGG + Intergenic
949853835 3:8442031-8442053 CTCCATCTCTCTCTTGAGTCAGG - Intergenic
950218801 3:11178782-11178804 CTTCATACGTCCCTTGTCTCTGG + Intronic
952523050 3:34181537-34181559 TACCATCAGCCTCTTGTGTCTGG - Intergenic
952880906 3:37985863-37985885 CACGATAAATCTCCTGTGTCAGG + Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
963970959 3:151429177-151429199 CTCCATGAGTCTCTGCTGGCTGG - Intronic
973200180 4:47491738-47491760 ATCTATAAATCTCTTCTGTCAGG + Intronic
975374082 4:73622030-73622052 CTCCATAACTCTCTGGTATGTGG + Intergenic
975441005 4:74410534-74410556 GTGCTTAAGTCTCTTGTGTGAGG - Intergenic
975739838 4:77419092-77419114 CTCCAGAACTCTCTAGTGTTGGG + Intronic
976143133 4:82014029-82014051 CTCCATAGTTCTTTTGTGGCAGG + Intronic
977927131 4:102713971-102713993 CTTCACAAGGCTGTTGTGTCAGG + Intronic
982827655 4:160020762-160020784 CTCTAGAAGTCTCCTGTGTCTGG + Intergenic
986644777 5:9906141-9906163 GTCCACAAGTCTCTCCTGTCTGG - Intergenic
988384857 5:30549408-30549430 CTCCATAAGTCTTTTGTCATAGG - Intergenic
989672535 5:43935779-43935801 CCCCATAAGTCTACTGTCTCTGG - Intergenic
994712895 5:103286917-103286939 TTCCAAAAATCTCTTGTGACTGG + Intergenic
995197594 5:109390363-109390385 CTCCTTAAATCTATTTTGTCTGG + Intronic
998930714 5:147178167-147178189 CTCCACAAGCCTATTGTATCAGG + Intergenic
999288783 5:150409919-150409941 CTCCAGGAGTCCCTTGTGCCTGG + Intronic
999401233 5:151265795-151265817 CTACAAAAGACTCTTGTGCCTGG - Intronic
1000035253 5:157442946-157442968 CTCCCAAAGTTTCTAGTGTCTGG - Intronic
1002419453 5:179138031-179138053 ATCCCTAAGTCTCAGGTGTCCGG + Intronic
1005835289 6:29704155-29704177 CTCCCTGAGGCTCTTGTTTCTGG + Intergenic
1012219866 6:96636341-96636363 CTTCATAAGTCTGTTTTGTTTGG - Intergenic
1012644004 6:101657183-101657205 CTCCTTAATTCTCATGTGTCTGG + Intronic
1018157118 6:160995511-160995533 CTGCATAACACTCTTGGGTCAGG - Intronic
1020584767 7:10052681-10052703 CTGCATAAATCTCTTCTGTTGGG - Intergenic
1028580433 7:92404086-92404108 CTCCTTTAGCCTCTTGTTTCAGG - Intergenic
1032600286 7:133286684-133286706 AGCCATATGTCTCTTGTGTTGGG + Intronic
1033622528 7:143075177-143075199 CTTCATTAGTCACTGGTGTCAGG - Intergenic
1036096227 8:5727322-5727344 CTCCATCAATTCCTTGTGTCTGG - Intergenic
1038353722 8:26806674-26806696 CTCCCTAAGTCTCTTTACTCTGG + Intronic
1038694402 8:29793267-29793289 CTCAGTAAGTATCTTGTGGCTGG - Intergenic
1040129867 8:43782793-43782815 CACCATAGGTCTCTTTTGGCTGG - Intergenic
1040885989 8:52264512-52264534 TCCCTTAAGCCTCTTGTGTCTGG - Intronic
1041976990 8:63810740-63810762 CCCCATAATCCTCATGTGTCAGG - Intergenic
1043764972 8:84119836-84119858 CTAAAGAAGTCTCTTGTCTCCGG + Intergenic
1048564609 8:135582046-135582068 CTCCATAAGTCTCTTGTGTCGGG - Exonic
1051617841 9:19023413-19023435 CTCAATAACTCTGTTGAGTCAGG + Intronic
1051893479 9:21966010-21966032 CTCCATATATCTCCTGTGCCTGG - Intronic
1051979582 9:22997821-22997843 TTCCATAGATCTCTTGTGCCAGG + Intergenic
1052254618 9:26440289-26440311 CTCCATAAGTCTCTTTGTCCAGG + Intergenic
1052380620 9:27767075-27767097 CTAGATAAGTCTTTGGTGTCGGG + Intergenic
1052498499 9:29258945-29258967 AACCATAAGACTCTAGTGTCAGG + Intergenic
1056052941 9:82788975-82788997 CCCCATAATCCTCATGTGTCAGG - Intergenic
1061775101 9:132957547-132957569 CTTCATAAGGTTCTTGAGTCTGG - Intronic
1062069757 9:134549377-134549399 TTCCATAAGTCTGTTCTCTCCGG + Intergenic
1185470607 X:380275-380297 GTGCATATGTCTCTTGAGTCTGG - Intronic
1186591506 X:10934776-10934798 TTTCATATGTCTTTTGTGTCTGG + Intergenic
1190511487 X:51177826-51177848 CTCCACAAGCTTCTTGTGGCAGG - Intergenic
1191169351 X:57425349-57425371 TTCCTTGAGTCTCTTGTATCTGG - Intronic
1195144374 X:101999019-101999041 CTCTATATGTCTTTTTTGTCTGG - Intergenic
1196412411 X:115433987-115434009 CTCAATCAGCCTCTTGTGACTGG + Intergenic
1198186550 X:134259018-134259040 CTCCATAACTCTCCTGGGTCAGG + Intergenic