ID: 1048573105

View in Genome Browser
Species Human (GRCh38)
Location 8:135671038-135671060
Sequence TCCAGCTGGTTAGCAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048573105_1048573113 28 Left 1048573105 8:135671038-135671060 CCTGGCTTTGCTAACCAGCTGGA No data
Right 1048573113 8:135671089-135671111 TAACTCTTGATTCTCTGACCTGG No data
1048573105_1048573114 29 Left 1048573105 8:135671038-135671060 CCTGGCTTTGCTAACCAGCTGGA No data
Right 1048573114 8:135671090-135671112 AACTCTTGATTCTCTGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048573105 Original CRISPR TCCAGCTGGTTAGCAAAGCC AGG (reversed) Intergenic
No off target data available for this crispr